Transcript asmbl_73297

Sequence
Transcript Sequence for observation asmbl_73297 of TGE0058691:
AGAGAAGACTGGCGAAAGTGATGAGTCTAAAAAAGTAGTCCCTCCGGTTCCTCTGTTTCCCCCCATGTGGCGTCAGGAAGCGAGGCACCGGGCGCACTGCGCCCCGAATTCCTGCGCCCGCCGCGCGCGGCGCTCCGTGGAGGGGTACATAAGGCGGAGGGGGTGAGGCGACTGGGCGGAGTTCTGTCGCCGGGATCCTTCCGCTGGGCTCAGCCGTTTCCGGAGTCTGCGCTGCGCCCGGTTCCGCCATTGCGGCTCTCCTGGCCCCTGGAGCCTCCGCCCCCGACCCGAGCTCTTTCGTCTGCCTGCCAGTTTCCTGCGTCCCCGGAGAGGATCCTGCTGAGCCCAGCCTCCCCCCTCCCCTTCTCCTCCTCTCCCTTGGAGAGCCCGGGCAGCCACTGCCCCGCAGCCCCAGTGACAGGAGGAGACCATAACCCCCGACAGCGCCATGGCCCAGATTCTGCCAATTCGTTTTCAGGAGCATCTCCAGCTCCAGAACCTGGGTATCAACCCAGCAAACATTGGCTTCAGTACCCTGACTATGGAGTCTGACAAATTCATCTGCATTAGAGAAAAAGTAGGAGAGCAGGCCCAGGTGGTAATCATTGATATGAATGACCCAAGTAATCCAATTCGAAGACCAATTTCAGCAGACAGCGCCATCATGAATCCAGCTAGCAAAGTAATTGCACTGAAAGCTGGGAAAACTCTTCAGATTTTTAACATTGAAATGAAAAGTAAAATGAAGGCTCATACCATGACTGATGATGTCACCTTTTGGAAATGGATCTCTTTGAATACGGTTGCTCTTGTTACGGATAATGCAGTTTATCACTGGAGTATGGAAGGAGAGTCTCAGCCAGTGAAAATGTTTGATCGCCATTCTAGCCTTGCAGGGTGCCAGATTATCAATTACCGTACAGATGCAAAACAAAAGTGGTTACTTCTGACTGGTATATCTGCACAGCAAAATCGTGTGGTGGGAGCTATGCAGCTATATTCTGTAGATAGGAAAGTGTCTCAGCCCATTGAAGGACATGCAGCTAGCTTTGCACAGTTTAAGATGGAAGGAAATGCAGAAGAATCAACGTTATTTTGTTTTGCAGTTCGGGGCCAAGCTGGAGGGAAGTTACATATTATTGAAGTTGGCACACCACCTACAGGGAACCAGCCCTTTCCAAAGAAGGCAGTGGATGTCTTCTTTCCTCCAGAAGCACAAAATGATTTTCCTGTTGCAATGCAGATCAGTGAAAAGCATGATGTGGTGTTCTTGATAACCAAGTATGGTTATATCCACCTCTATGATCTTGAGACTGGTACCTGCATCTACATGAATAGAATCAGTGGAGAAACAATTTTTGTTACTGCACCTCATGAAGCCACAGCTGGAATAATTGGAGTAAACAGAAAGGGACAAGTTCTGTCAGTGTGTGTGGAAGAAGAAAACATAATTCCTTACATCACCAATGTTCTACAAAATCCTGATTTGGCTCTGAGAATGGCTGTACGTAATAACTTAGCCGGTGCTGAAGAACTCTTTGCCCGGAAATTTAATGCTCTTTTTGCCCAGGGAAATTACTCGGAGGCAGCAAAGGTGGCTGCTAATGCACCAAAGGGAATTCTTCGTACTCCAGACACTATCCGTCGGTTCCAGAGTGTCCCAGCCCAGCCAGGTCAAACTTCTCCTCTACTTCAGTACTTTGGTATCCTTTTGGACCAGGGACAGCTCAACAAATACGAATCCTTAGAGCTTTGTAGGCCTGTACTTCAGCAAGGGCGAAAACAGCTTTTGGAGAAATGGTTAAAAGAAGATAAGCTGGAATGTTCTGAAGAACTGGGTGATCTTGTGAAATCTGTGGACCCTACATTGGCACTTAGTGTGTACCTAAGGGCTAACGTCCCAAATAAAGTCATTCAGTGCTTTGCAGAAACAGGTCAAGTCCAAAAGATTGTTTTATATGCTAAAAAAGTTGGATACACTCCAGATTGGATATTTCTGCTGAGAAATGTAATGCGAATCAGTCCAGATCAGGGACAGCAGTTTGCCCAAATGTTAGTTCAAGATGAAGAGCCTCTTGCTGACATCACACAGATTGTAGATGTCTTTATGGAATACAATCTAATTCAGCAGTGTACTGCATTCTTGCTTGATGCTCTGAAGAATAATCGCCCATCTGAAGGTCCTTTACAGACGCGGTTACTTGAGATGAACCTTATGCATGCGCCTCAAGTTGCAGATGCTATTCTAGGCAATCAGATGTTCACACATTATGACCGGGCTCATATTGCTCAACTGTGTGAAAAGGCTGGCCTACTGCAGCGTGCATTAGAACATTTCACTGATTTATATGATATAAAACGTGCAGTGGTTCACACCCATCTTCTTAACCCTGAGTGGTTAGTCAACTACTTTGGTTCCTTATCAGTAGAAGACTCCCTAGAATGTCTCAGAGCCATGCTGTCTGCCAACATCCGTCAGAATCTGCAGATTTGTGTTCAGGTGGCTTCTAAATATCATGAACAACTGTCAACTCAGTCTCTGATTGAACTTTTTGAATCTTTCAAGAGTTTTGAAGGTCTCTTTTATTTTCTGGGATCCATTGTTAACTTTAGCCAGGACCCAGATGTGCACTTTAAATATATTCAGGCAGCTTGCAAGACTGGGCAAATCAAAGAAGTAGAAAGAATCTGTAGAGAAAGCAACTGCTACGATCCTGAGCGAGTCAAGAATTTTCTTAAGGAAGCAAAACTAACAGATCAGCTACCACTTATCATTGTGTGTGATCGATTTGACTTTGTCCATGATTTGGTGCTCTATTTATATAGAAATAATCTTCAAAAGTATATAGAGATATATGTACAGAAGGTGAATCCAAGTCGACTTCCTGTAGTTATTGGAGGATTACTTGATGTTGACTGTTCTGAAGATGTCATAAAAAACTTGATTCTTGTTGTAAGAGGTCAATTCTCTACTGATGAGCTTGTTGCTGAGGTTGAAAAAAGAAACAGATTGAAACTGCTTCTGCCTTGGCTAGAGGCCAGAATTCATGAGGGCTGTGAGGAGCCTGCTACTCACAATGCCTTAGCCAAAATCTACATAGACAGTAATAACAACCCGGAGAGATTTCTTCGTGAAAATCCCTACTATGACAGTCGCGTTGTTGGAAAGTATTGTGAGAAGAGAGATCCACATCTGGCCTGTGTTGCTTATGAACGTGGCCAATGTGATCTGGAACTTATTAATGTTTGCAATGAGAATTCCCTCTTCAAAAGTCTTTCTCGCTACCTGGTACGTCGAAAGGATCCAGAATTGTGGGGCAGCGTGCTGCTGGAAAGCAATCCTTACAGGAGACCCCTAATTGACCAGGTTGTACAAACAGCTTTGTCTGAGACTCAGGACCCTGAAGAAGTGTCAGTAACTGTAAAGGCTTTCATGACTGCAGACCTTCCTAATGAACTCATTGAACTGCTGGAGAAAATTGTCCTTGATAACTCTGTATTCAGTGAACACAGGAATCTGCAAAACCTCCTTATCCTCACTGCAATTAAGGCTGACCGTACACGTGTTATGGAGTATATTAACCGCCTGGATAATTATGATGCCCCAGATATTGCCAATATCGCCATCAGCAATGAGCTGTTTGAAGAAGCATTTGCCATTTTCCGGAAATTTGATGTCAATACTTCAGCAGTTCAGGTCTTAATTGAGCATATTGGAAACTTGGATCGGGCATATGAGTTTGCTGAACGTTGCAATGAACCTGCGGTCTGGAGTCAACTTGCAAAAGCCCAGTTGCAGAAAGGAATGGTGAAAGAAGCCATTGATTCTTATATCAAAGCAGATGATCCTTCCTCCTACATGGAAGTTGTTCAGGCTGCCAATACTAGTGGAAACTGGGAAGAACTGGTGAAGTACTTGCAGATGGCCCGTAAGAAGGCTCGAGAGTCCTATGTGGAGACAGAACTGATATTCGCACTGGCTAAAACAAACCGCCTTGCAGAGTTAGAAGAATTTATCAATGGACCAAATAATGCTCATATCCAACAAGTTGGTGACCGTTGTTATGATGAAAAAATGTATGATGCTGCTAAGTTGTTGTACAATAATGTTTCCAATTTTGGACGTTTGGCATCTACCCTGGTTCACCTGGGTGAATATCAGGCAGCTGTTGATGGGGCTAGGAAAGCTAACAGTACTCGAACATGGAAAGAGGTCTGCTTCGCCTGTGTAGATGGGAAAGAATTCCGTCTTGCTCAGATGTGTGGACTTCATATTGTTGTACATGCAGATGAATTAGAAGAACTTATCAACTACTATCAGGATCGTGGCTATTTTGAAGAGCTGATCACCATGTTGGAAGCAGCACTGGGACTTGAGCGAGCTCACATGGGAATGTTTACTGAATTAGCTATTCTATACTCTAAATTTAAGCCTCAGAAAATGAGGGAGCACCTGGAGCTGTTCTGGTCTAGAGTGAATATTCCCAAGGTGCTAAGAGCTGCAGAACAAGCTCATCTTTGGGCAGAACTGGTGTTTTTGTATGACAAGTATGAAGAATATGATAATGCCATAATTACCATGATGAATCATCCAACTGATGCCTGGAAAGAAGGGCAATTCAAAGATATCATTACCAAGGTTGCCAATGTGGAACTATACTACAGAGCAATACAGTTCTACTTAGAATTCAAGCCTCTGTTGTTAAATGATTTGCTGATGGTGCTGTCTCCACGGTTGGATCACACTCGTGCAGTCAATTATTTCAGCAAGGTTAAACAGCTACCACTGGTGAAACCGTATTTGCGTTCAGTTCAGAACCATAACAACAAATCTGTGAATGAATCATTGAACAATCTTTTTATTACAGAAGAAGATTATCAGGCTCTGCGAACATCAATAGATGCTTATGACAACTTTGACAATATCTCGCTTGCTCAGCGTTTGGAAAAACATGAACTCATTGAGTTCAGGAGAATTGCTGCTTATCTCTTCAAAGGCAACAATCGCTGGAAACAGAGTGTAGAGCTGTGCAAGAAAGACAGCCTTTACAAGGATGCAATGCAGTATGCTTCTGAATCTAAAGATACTGAATTGGCTGAAGAACTCCTGCAGTGGTTTTTGCAGGAAGAAAAAAGAGAGTGCTTTGGAGCTTGTCTGTTTACCTGTTACGATCTTTTAAGGCCAGATGTCGTCCTAGAAACTGCATGGAGGCACAATATCATGGATTTTGCCATGCCCTATTTCATCCAGGTCATGAAGGAGTACTTGACAAAGGTTGATGCAATAAAGGAAAAGGTGGATAAATTAGATGCTTCAGAATCACTGAGAAAAGAAGAAGAACAAGCTACAGAGACACAACCCATTGTTTATGGTCAGCCCCAGTTGATGCTGACAGCAGGACCCAGTGTTGCCGTCCCTCCCCAGGCACCTTTTGGTTATGGTTATACCGCACCACCGTATGGACAGCCACAGCCTGGCTTTGGGTACAGCATGTGAGATGAAGCGCTGATCCTGTAGTCACCTATTTTCGTACTGAAACATCGTCTTTACCCACTTCTCAGTTTATAATGGGGGAAAACAGGCAACGTGTTCTTGTAACCTTTATTTCATGAAGGACTTCTTTTTGTTTCTAACTATAAACTTGGATCACCTATGTTAAAACCTTATTTCACATTCCACATCATTTTAGAATTTATTTTCGAAGGGGAATAGTTTCAATGTTTTATTCACTTGGGCTTTTTTTCTTCCCCCTCTTTCTTTAAAGAACTGCTCAATATTCAATCTGTTGTGAAGAACCTGATTTGCACTCTGTAGTGTTTAAAGAAACAAAGAAACTCTAATATTGAATCTCTTAAATTTAGTGTATGTAAACAGCTTACAAATACGTATTGTCTAAATGCATTTAAATCTGTTTTATTCAAAGAAAAGCTAAAGCAAAAACACTGGCATATGACCATGCAAGACTGTCAGTGCCAACAAAGACAACACTAATCAGCACATCGTACACTGGATTGCAGTGCTTCCCAGATTATTGAAAAATGTTACAGACAACTTGCCTGATTTTTAAATGAGCGTAAAAGGCCCTCTAACCTATGCAGGTTTCCCCATTATGCATATAGAAAATGCTAGTATGTTTTGCTCACTTCATATGTAACAGGTGCCCTTATGTTGTGCTGTATCCTGTGCTTTTTCTGTGGGACCATTCCATTCAGGAGCAAAGAGCACCATGATTCCAATCTTGTGTGTGTTTACTAACCCTTCCCTGAGGTTTGTGTATGTTGGATATTGTGGTGTTTTAGATCACTGAGTGTACAGAAGAGAGAAATTCAAACAAAATATTGCTGTTCTTCAGTTTTGTTTGTGGAATTTGAAATTACTCAAATTTAAAATAAATTACTGGACTGTGGAAATAACATAGAATTGAAGTTTTAATTAAATACCACTCAAACGAAAAGAACAGTAGTTTTTGTAGTTTTATATTGGATACTGAGGCATTAGGGAGGCATGAAAGGAAGAGGAATGAGGATTGAGACATGTGAAGACATTGTGCATTATATCAATGTGCATTCCTGTAGTTCATTAACAAGGTACATGCAATAGTCTAAAGAACCAGAGTCACTACTATAGTGGCTTAACATTTAATCTGTCTCCAATATTTTAACCAAGTGACACCGAGGTTTTTATCGAAGCATTTCACTTAAATGAACAAATCATGGCTGTTATATTAACTTGAAATAAAATATATTTAAACATGTA