Transcript asmbl_73044

Sequence
Transcript Sequence for observation asmbl_73044 of TGE0056560:
CTGGATGTAGCAGGTAAGACATTTTGGTGGGGAGAAGGCTTCTGGAAGAAGGGCTGAAAAGTTGTTTCCATTAGCTTTGGGTTTTATGTAGATTATCCCAGAAAGGAAGACGTGGATTTTTGTACTTCCCCTTTTGCTGGATGGGAGAGAGTTGGCTGCTGAGTTTTATTTGGATCTTAGCTCACTGGCTGGGTGCAAAGCTGCAGCCTTCCTCTACGTGACCTCATCCAAAGATCTTGGGAAATGGCCGAGCTCAGGGAGGAGGCAGGATTTGGGCTAACAGTGTCCCCATTGCCCTCTTCTCTCCCTTGTACTTATATGGGCTCTGCTGCTGGGAGCAGCCTTCTGTTTGTCAGCTCAGTTCTGTGTCTGGCCTGTGGTGGTGGTGTTTTGGAGGATCTCTTTGCATTCTACCACGTCCCTGGCATGTGCAGGTCAGTCATTCCAGGTTGTACATTTCCTTTGGAGATGGACCCTCCTCCCTGATTTTCCTTCTTTCTCTGGGCACAATTCACCTAAGTGTGAGGGGTCACATGGATCCCGTGGAGCATTCTGGATAGATCCTGGAGTCTGGTCACAGAGAGAGCCAAGGCTACATGATGGCTTGGAGTCTTCATCTTTGTCTTTTCACTGTCTTTCCCCACATTGAGTCAGTCACCAGGTGTTTTTTTTTGGTTTTGTTTTATTTTGTTTTGTTTCTGTTTTGCACCTGCAGTATCTCGGCAGGTCAGACTGTCATGCCGTGCAGGTGCCAGCCCTCTCTCTGCTGTTTTTGCTCTTGTTGCTCTCAGAGCCAAGAGCCACTCTGCACCCAGAGGGCCTCCCATCCACACCAGCCTGCCCTTTACTCAGCTCTCACTTTCGTCATCACCTGTGGGATCCTGTCTGCAGAACCCCCTCAAAACTCTTTCCTTCACGGTGCAGCTCCACCCTGCCTTGCTGTGCTCTGCACAGCTACACCCAAATTCTCCATGTCCCTGGACACGCACTTCACATGTTACAGTCAGGCATCCTCCTGTTTGCTTATGCTTTGTCTCTGCTTAGAATGTCCTTCCATATCATCTTTTCTGGTAATGTCCTTTAAGGCCAGGCTGAAAAGTTGCCCGGAAGGGCCCCCTTTTCCTGCCTGCAACTGTATTCCTGTGATCCGGAAGTTGCCTAGGCCATGCTCCTCTCACAGGACAGGCCAGTCAGTGGTTTGTCTGTCTGCGTGGAAAGCAAGAGGGTAAGGATGATCATTCATCTCTATCCCCAGGGACGAGTACAGTCCTCTCTGCTAATGAATGTTGAAAGAATGAATGAGTGAAATGGAATGAACTCCCTGATGAAGTATTTTAATTTACAGGTCAACAGCTTTGGCTAAAGGATTGGAGGTATCCTGGGGAGAGGGAAGAGAAGGAGGGGCACACTCAGTTCTGGGCTGCTCTTTGGCCCCCACTCTGAAGCCAGATGGGGGCAGAGTCCAGAGGGGCCAGGGCAGTTGCCTGACAGGCCCTCCCCTATCCCACCCTGAGCAGGACTGGAGAACTGGGTCTGGGCCGAGGATATGGTCTTTGTCCCCATGGCTGTGCCCTGGAGCCCTGAGCACCAGCTGCAGAGGCTGCAGGTGACCCGGAAGCTGCTGGAGATGGAGGAGCAGGCCGCCTTCCTCGTGGGAAGCGCCACCCCTCGCTACCTGTACCTGGCCAGCAACCACAGCAACAAGTGGGGTCACCCCCGGGGCTACCGCATCCAGATGCTCAGCTTTGCTGGAGAGCCGCTGCCCCAAAACAGCTCCATGGCGAGAGGCTTCAGCTGGGAGAGGTACCAGCTGGCTGTGACCCAGCGGAAGGAGGAGGAGCCCAGTAGCAGCAGCGTTTTCAATCAGAATGACCCTTGGGCCCCCACTGTGGATTTCAGTGACTTCATCAACAATGAGACCATTGCTGGAAAGGATTTGGTGGCCTGGGTGACAGCTGGTTTTCTGCATATCCCACATGCAGAGGACATTCCTAACACAGTGACTGTGGGGAACGGCGTGGGCTTCTTCCTCCGACCCTATAACTTCTTTGACGAAGACCCCTCCTTCTACTCTGCCGACTCCATCTACTTCCGAGGGGACCAGGATGCTGGGGCCTGCGAGGTCAACCCCCTAGCTTGCCTGCCCCAGGCTGCTGCCTGTGCCCCCGACCTCCCTGCCTTCTCCCACGGGGGCTTCTCTCACAACTAGGCGGTCCTGGGATGGGGCATGTGGCCAAGGGCTCCAGGGCCAGGGTGTGAGGGATGGGGAGCAGCTGGGCACTGGGCCGGCAGCCTGGTTCCCTCTTTCCTGTGCCAGGACTCTCTTTCTTCCACTACCCTCCCTCGCATCCGCCTCTGAGCCAGGAGCCTCCTGACCCTGTGATGCCTGACACAGGGGACACTGAACCTTGTTGATGCCAGCTGTACTGAGTTCTCATCCACAGAGGCCAGGCATGGCCCAGCCTGGAGCCGTGGCCGAGGGCTTCCCTAGATGGTTCCCTTTGTTGCTGTCTGGCTTTCCCGAATCTTTTTAGGCCACCTCCAAGGACTCTAAAAGGGGGCTATTCCCTGGAGACCCCAGAGTAGGGTTGCCAGTCCTGCAAGTCCATAGCTGAGCTGGAAAGGATGCTTCTGCTCACATTCCCTCTCATCCAGGTCCTTTCCTTCTCGTCTTCCTCTCTCTCACCTACTTCCTCCTCCTCCTCCTGTTCCTGCCTTCTCTTCTATCCTGCAATTTCTCCCGAATCCTGAGGGGATATCCCTATGTCCCAGCCCCTGGTACTCCCCCAGCCCTCAGTTTTCAGTCAAGTTCCGTCTCCTCTCCAGCCCTATGGAAGTCTCAAGGTCACGGGACCCCTAATCAGAGTGGCCAATCCCTGTGTGTCGTTCCCTTGTGTCTGTTGCTTATTGGGAGTAGGAGTTGCTCCTACCCCTGTCCTGGGGCTGGGTGTGTTTCAGGACAGCTGCTTCTGTGCATTTGTGTCTGCCTGCCTCATGCTCTCTATAGAGGAGGATGGTCATCGTGACAGCAGCAGCTCAAGTTAGCATTTCAAGTGATTTGGGGGTGCAATGATAATGAAGAATGGCCATTTTGTACCAGGGCTCTGTATTCTGCAACAGCCTGTTTGGGAGGCTGGAGTGGAAACAAAGGGTGGGCATCAAAGATGAGAAGCCAAAGCCCCTACAACTCCAGCCACCCAGCCAGGAGGGGCTGTCCAATCACATTCAGGCATGCGAATGAGCTGGGCCCTGGGTGAGGTGGGGGTCTGGCCTAGTGGGGAGGGGCCTGGCCTGGGTGGGGCAGGGCCTGGCCTGGTCCAGGCTTGGGCTCCATTCCCATCACTGCTGTCCCTCCTGAGGTCTGGATTGGGGATGGGGACAAAGAAATAGCAAGAGATGAGAAACAACAGAAACTTTTTTCTCTAAAGGACTGGTTAAATCAATTCTGATACAGCCTTACAATACAATAGTATGCAGCTAAAAAATAATTGTATGTCTTTATATACTAATATGTAATAATCTTCAGGTGAAAAAGGCAAGCCACAGAAATGTGTATAGCGCACTTCCCATTTGTGTTTCAGAAAGGAGTAGAATATAAACACATAATTGCTTATGTATGCCTATTCAGAATAAATGGGTAACACTGATTACTTTTGGGAGGGGAACCAGTAGGTTGAGGACAGGAGAGGGAAGGGTCTTAACACTTACACCCTTTTGTACATTTTGAATTTTGAACCATGTGACTGTATTACCTATTCAAAATAAACAATAAATGGGCCCAAACAGGA