Transcript asmbl_72757

Sequence
Transcript Sequence for observation asmbl_72757 of TGE0058688:
GGCTTTGGGTCGAGCTCAGTCCTCCCCCGGCGCCTCCGACTGGCAGTGGGACTCAGCGGGCGTGGAGGTCGCGGCTGAGCGAGCGAGCCCTGGGCGAGTGAATTGTGGCTGTGGGTTGACGGTGGAGACACCCCCCGGAGGGAGGCGGAGGGAAGGGAGGCGAGGCCTGCACCTGCATGCTTCCCGCCTCCCACTCCCCAGCGCCCCCGGACCGTGCAGTTCTCTGCAGGACCAGGCCATGGAGCTCGAAGTCCGGCGGGTCCGACAGGCGTTCCTGTCCGGCCGGTCGCGACCTCTGCGGTTTCGGCTGCAGCAGCTGGAGGCCCTGCGGAGGATGGTGCAGGAGCGCGAGAAGGATATCCTGACGGCCATCGCCGCCGACCTGTGCAAGAGTGAATTCAATGTGTACAGTCAGGAAGTCATTACTGTCCTTGGGGAAATTGATTTTATGCTTGAGAATCTTCCTGAATGGGTTACTGCTAAACCAGTTAAGAAGAACGTGCTCACCATGCTGGATGAGGCCTATATTCAGCCACAGCCTCTGGGAGTGGTGCTGATAATCGGAGCTTGGAATTACCCCTTCGTTCTCACCATTCAGCCACTGATAGGAGCCATCGCTGCAGGAAATGCTGTGATTATAAAGCCTTCTGAACTGAGTGAAAATACAGCCAAGATCTTGGCAAAGCTTCTCCCTCAGTATTTAGACCAGGATCTCTATATTGTTATTAATGGTGGTGTTGAGGAAACCACGGAGCTCCTGAAGCAGCGATTTGACCACATTTTCTATACGGGAAACACTGCGGTTGGCAAAATTGTCATGGAAGCTGCTGCCAAGCATCTGACCCCTGTGACTCTTGAACTGGGAGGGAAAAGTCCATGTTATATTGATAAAGATTGTGACCTGGACATTGTTTGCAGACGCATAACCTGGGGAAAATACATGAATTGTGGCCAAACCTGCATTGCACCCGACTATATTCTCTGTGAAGCATCCCTCCAAAATCAAATTGTATGGAAGATTAAGGAAACAGTGAAGGAATTTTATGGAGAAAATATAAAAGAGTCTCCTGATTATGAAAGGATCATCAATCTTCGTCATTTTAAGAGGATACTAAGTTTGCTTGAAGGACAAAAGATAGCTTTTGGTGGGGAGACTGATGAGGCCACACGCTACATAGCCCCAACAGTACTTACCGATGTTGATCCTAAAACCAAGGTGATGCAAGAAGAAATTTTTGGACCAATTCTTCCAATAGTGCCTGTGAAAAATGTAGATGAGGCCATAAATTTCATAAATGAACGTGAAAAGCCTCTGGCTCTTTATGTATTTTCGCATAACCATAAGCTCATCAAACGGATGATTGATGAGACATCCAGTGGAGGTGTCACAGGCAATGACGTCATTATGCACTTCACGCTCAACTCTTTCCCATTTGGAGGAGTGGGTTCCAGTGGGATGGGAGCTTATCACGGAAAACATAGTTTTGATACTTTTTCTCATCAGCGTCCCTGTTTATTAAAAAGTTTAAAGAGAGAAGGTGCTAACAAACTCAGATATCCTCCCAACAGCCAGTCAAAGGTGGATTGGGGAAAATTTTTTCTCTTGAAACGGTTCAACAAAGAAAAACTCGGTCTCCTGTTGCTCACTTTCCTGGGTATTGTAGCCGCTGTGCTTGTCAAGAAATACCAAGCTGTGCTGAGGAGAAAGGCCCTGTTGATTTTTCTGGTAGTTCACAGACTGCGTTGGTCCAGTAAGCAGAGATGAACACCAGATTTCAAAACCCAGCCCTGTCTGTTAAGAGTGAGGCAGAATATTACTGAAGAATGATCCTGTTCAACCTCCTAGTGCCTCTACTGAATTATTCCTCTTTTAAATGGTTAATGAACCAATAATTTTTAAATCATACCAAAAATAGTAAGAAAATATGCAAACACTCTGTGATCAAACTTAAAAGTCATTGCCATTCATCATTAATAAAAGTTGCCATTTCAACTACGTCCCAACATTCCCTAATAGGGTATTCAGGGAACCTGTCTTAAATTGTGCTTATCTAAATCTTGGAACTTTGAGCTAGGGGAGGAGAATGTATTAGACTAAATACAAACTGCGGGGTTGTAAGGGAGTCTCAGAACCTCACTGAATCCTTCACTCCAGTTAATGGCACTGCTCACTTCCTGCCTCTGCTGCCACCATCACTGTGTGAAGCTTTCAAGAGCTTGGTACTTCCCAGGGCTACCGGCAGTCCTCTGTAGTCCAGAGAGGTGAGATTAGATCTTCTTGGTTCCCTGTGAGGTTTCAGGCACTAAAACTCTATGTGGGGAAGGGAGGGGTTACTCCTCCTCCAATGGGACTCAAGGACTTGACCTCCAGGAGTAGGCCCCTGGTCAGAAGTGCCATCTCACCAGTGGTCTTCATTCTTCCTCATTCATTCTTTATCATCCTGTGTTCTGTTTAGTTGCAACAATCTCTTGTGACTAATGTCACTCAAAGCATCTTGTAAATCCTAGGGCTTCCTGGAAGTTAGTTGCCAAAGTCATGCAAGCATCACCTGTCATTCTTGTGTTGGAGTTATAGAATTCTACATCTTATAAAACCTAACTGGCATTTAAAAAATACTGTGGCCGGGCGTGGTGGCTCATGCC