Transcript asmbl_72756

Sequence
Transcript Sequence for observation asmbl_72756 of TGE0058690:
GGCTTTGGGTCGAGCTCAGTCCTCCCCCGGCGCCTCCGACTGGCAGTGGGACTCAGCGGGCGTGGAGGTCGCGGCTGAGCGAGCGAGCCCTGGGCGAGTGAATTGTGGCTGTGGGTTGACGGTGGAGACACCCCCCGGAGGGAGGCGGAGGGAAGGGAGGCGAGGCCTGCACCTGCATGCTTCCCGCCTCCCACTCCCCAGCGCCCCCGGACCGTGCAGTTCTCTGCAGGACCAGGCCATGGAGCTCGAAGTCCGGCGGGTCCGACAGGCGTTCCTGTCCGGCCGGTCGCGACCTCTGCGGTTTCGGCTGCAGCAGCTGGAGGCCCTGCGGAGGATGGTGCAGGAGCGCGAGAAGGATATCCTGACGGCCATCGCCGCCGACCTGTGCAAGAGTGAATTCAATGTGTACAGTCAGGAAGTCATTACTGTCCTTGGGGAAATTGATTTTATGCTTGAGAATCTTCCTGAATGGGTTACTGCTAAACCAGTTAAGAAGAACGTGCTCACCATGCTGGATGAGGCCTATATTCAGCCACAGCCTCTGGGAGTGGTGCTGATAATCGGAGCTTGGAATTACCCCTTCGTTCTCACCATTCAGCCACTGATAGGAGCCATCGCTGCAGGAAATGCTGTGATTATAAAGCCTTCTGAACTGAGTGAAAATACAGCCAAGATCTTGGCAAAGCTTCTCCCTCAGTATTTAGACCAGGATCTCTATATTGTTATTAATGGTGGTGTTGAGGAAACCACGGAGCTCCTGAAGCAGCGATTTGACCACATTTTCTATACGGGAAACACTGCGGTTGGCAAAATTGTCATGGAAGCTGCTGCCAAGCATCTGACCCCTGTGACTCTTGAACTGGGAGGGAAAAGTCCATGTTATATTGATAAAGATTGTGACCTGGACATTGTTTGCAGACGCATAACCTGGGGAAAATACATGAATTGTGGCCAAACCTGCATTGCACCCGACTATATTCTCTGTGAAGCATCCCTCCAAAATCAAATTGTATGGAAGATTAAGGAAACAGTGAAGGAATTTTATGGAGAAAATATAAAAGAGTCTCCTGATTATGAAAGGATCATCAATCTTCGTCATTTTAAGAGGATACTAAGTTTGCTTGAAGGACAAAAGATAGCTTTTGGTGGGGAGACTGATGAGGCCACACGCTACATAGCCCCAACAGTACTTACCGATGTTGATCCTAAAACCAAGGTGATGCAAGAAGAAATTTTTGGACCAATTCTTCCAATAGTGCCTGTGAAAAATGTAGATGAGGCCATAAATTTCATAAATGAACGTGAAAAGCCTCTGGCTCTTTATGTATTTTCGCATAACCATAAGCTCATCAAACGGATGATTGATGAGACATCCAGTGGAGGTGTCACAGGCAATGACGTCATTATGCACTTCACGCTCAACTCTTTCCCATTTGGAGGAGTGGGTTCCAGTGGGATGGGAGCTTATCACGGAAAACATAGTTTTGATACTTTTTCTCATCAGCGTCCCTGTTTATTAAAAAGTTTAAAGAGAGAAGGTGCTAACAAACTCAGATATCCTCCCAACAGCCAGTCAAAGGTGGATTGGGGAAAATTTTTTCTCTTGAAACGGTTCAACAAAGAAAAACTCGGTCTCCTGTTGCTCACTTTCCTGGGTATTGTAGCCGCTGTGCTTGTCAAGGCAGAATATTACTGAAGAATGATCCTGTTCAACCTCCTAGTGCCTCTACTGAATTATTCCTCTTTTAAATGGTTAATGAACCAATAATTTTTAAATCATACCAAAAATAGTAAGAAAATATGCAAACACTCTGTGATCAAACTTAAAAGTCATTGCCATTCATCATTAATAAAAGTTGCCATTTCAACTACGTCCCAACATTCCCTAATAGGGTATTCAGGGAACCTGTCTTAAATTGTGCTTATCTAAATCTTGGAACTTTGAGCTAGGGGAGGAGAATGTATTAGACTAAATACAAACTGCGGGGTTGTAAGGGAGTCTCAGAACCTCACTGAATCCTTCACTCCAGTTAATGGCACTGCTCACTTCCTGCCTCTGCTGCCACCATCACTGTGTGAAGCTTTCAAGAGCTTGGTACTTCCCAGGGCTACCGGCAGTCCTCTGTAGTCCAGAGAGGTGAGATTAGATCTTCTTGGTTCCCTGTGAGGTTTCAGGCACTAAAACTCTATGTGGGGAAGGGAGGGGTTACTCCTCCTCCAATGGGACTCAAGGACTTGACCTCCAGGAGTAGGCCCCTGGTCAGAAGTGCCATCTCACCAGTGGTCTTCATTCTTCCTCATTCATTCTTTATCATCCTGTGTTCTGTTTAGTTGCAACAATCTCTTGTGACTAATGTCACTCAAAGCATCTTGTAAATCCTAGGGCTTCCTGGAAGTTAGTTGCCAAAGTCATGCAAGCATCACCTGTCATTCTTGTGTTGGAGTTATAGAATTCTACATCTTATAAAACCTAACTGGCATTTAAAAAATACTGTGGCCGGGCGTGGTGGCTCATGCC