Transcript asmbl_72755

Sequence
Transcript Sequence for observation asmbl_72755 of TGE0058689:
GGCTTTGGGTCGAGCTCAGTCCTCCCCCGGCGCCTCCGACTGGCAGTGGGACTCAGCGGGCGTGGAGGTCGCGGCTGAGCGAGCGAGCCCTGGGCGAGTGAATTGTGGCTGTGGGTTGACGGTGGAGACACCCCCCGGAGGGAGGCGGAGGGAAGGGAGGCGAGGCCTGCACCTGCATGCTTCCCGCCTCCCACTCCCCAGCGCCCCCGGACCGTGCAGTTCTCTGCAGGACCAGGCCATGGAGCTCGAAGTCCGGCGGGTCCGACAGGCGTTCCTGTCCGGCCGGTCGCGACCTCTGCGGTTTCGGCTGCAGCAGCTGGAGGCCCTGCGGAGGATGGTGCAGGAGCGCGAGAAGGATATCCTGACGGCCATCGCCGCCGACCTGTGCAAGAGTGAATTCAATGTGTACAGTCAGGAAGTCATTACTGTCCTTGGGGAAATTGATTTTATGCTTGAGAATCTTCCTGAATGGGTTACTGCTAAACCAGTTAAGAAGAACGTGCTCACCATGCTGGATGAGGCCTATATTCAGCCACAGCCTCTGGGAGTGGTGCTGATAATCGGAGCTTGGAATTACCCCTTCGTTCTCACCATTCAGCCACTGATAGGAGCCATCGCTGCAGGAAATGCTGTGATTATAAAGCCTTCTGAACTGAGTGAAAATACAGCCAAGATCTTGGCAAAGCTTCTCCCTCAGTATTTAGACCAGGATCTCTATATTGTTATTAATGGTGGTGTTGAGGAAACCACGGAGCTCCTGAAGCAGCGATTTGACCACATTTTCTATACGGGAAACACTGCGGTTGGCAAAATTGTCATGGAAGCTGCTGCCAAGCATCTGACCCCTGTGACTCTTGAACTGGGAGGGAAAAGTCCATGTTATATTGATAAAGATTGTGACCTGGACATTGTTTGCAGACGCATAACCTGGGGAAAATACATGAATTGTGGCCAAACCTGCATTGCACCCGACTATATTCTCTGTGAAGCATCCCTCCAAAATCAAATTGTATGGAAGATTAAGGAAACAGTGAAGGAATTTTATGGAGAAAATATAAAAGAGTCTCCTGATTATGAAAGGATCATCAATCTTCGTCATTTTAAGAGGATACTAAGTTTGCTTGAAGGACAAAAGATAGCTTTTGGTGGGGAGACTGATGAGGCCACACGCTACATAGCCCCAACAGTACTTACCGATGTTGATCCTAAAACCAAGGTGATGCAAGAAGAAATTTTTGGACCAATTCTTCCAATAGTGCCTGTGAAAAATGTAGATGAGGCCATAAATTTCATAAATGAACGTGAAAAGCCTCTGGCTCTTTATGTATTTTCGCATAACCATAAGCTCATCAAACGGATGATTGATGAGACATCCAGTGGAGGTGTCACAGGCAATGACGTCATTATGCACTTCACGCTCAACTCTTTCCCATTTGGAGGAGTGGGTTCCAGTGGGATGGGAGCTTATCACGGAAAACATAGTTTTGATACTTTTTCTCATCAGCGTCCCTGTTTATTAAAAAGTTTAAAGAGAGAAGGTGCTAACAAACTCAGATATCCTCCCAACAGCCAGTCAAAGGTGGATTGGGGAAAATTTTTTCTCTTGAAACGGTTCAACAAAGAAAAACTCGGTCTCCTGTTGCTCACTTTCCTGGGTATTGTAGCCGCTGTGCTTGTCAAGGAAGTGAGCAGCGTCTCTGCTTGGCTGCCCATCGTCTGGGATGTG