Transcript asmbl_72754

Sequence
Transcript Sequence for observation asmbl_72754 of TGE0058688:
GGCTTTGGGTCGAGCTCAGTCCTCCCCCGGCGCCTCCGACTGGCAGTGGGACTCAGCGGGCGTGGAGGTCGCGGCTGAGCGAGCGAGCCCTGGGCGAGTGAATTGTGGCTGTGGGTTGACGGTGGAGACACCCCCCGGAGGGAGGCGGAGGGAAGGGAGGCGAGGCCTGCACCTGCATGCTTCCCGCCTCCCACTCCCCAGCGCCCCCGGACCGTGCAGTTCTCTGCAGGACCAGGCCATGGAGCTCGAAGTCCGGCGGGTCCGACAGGCGTTCCTGTCCGGCCGGTCGCGACCTCTGCGGTTTCGGCTGCAGCAGCTGGAGGCCCTGCGGAGGATGGTGCAGGAGCGCGAGAAGGATATCCTGACGGCCATCGCCGCCGACCTGTGCAAGAGTGAATTCAATGTGTACAGTCAGGAAGTCATTACTGTCCTTGGGGAAATTGATTTTATGCTTGAGAATCTTCCTGAATGGGTTACTGCTAAACCAGTTAAGAAGAACGTGCTCACCATGCTGGATGAGGCCTATATTCAGCCACAGCCTCTGGGAGTGGTGCTGATAATCGGAGCTTGGAATTACCCCTTCGTTCTCACCATTCAGCCACTGATAGGAGCCATCGCTGCAGGAAATGCTGTGATTATAAAGCCTTCTGAACTGAGTGAAAATACAGCCAAGATCTTGGCAAAGCTTCTCCCTCAGTATTTAGACCAGGATCTCTATATTGTTATTAATGGTGGTGTTGAGGAAACCACGGAGCTCCTGAAGCAGCGATTTGACCACATTTTCTATACGGGAAACACTGCGGTTGGCAAAATTGTCATGGAAGCTGCTGCCAAGCATCTGACCCCTGTGACTCTTGAACTGGGAGGGAAAAGTCCATGTTATATTGATAAAGATTGTGACCTGGACATTGTTTGCAGACGCATAACCTGGGGAAAATACATGAATTGTGGCCAAACCTGCATTGCACCCGACTATATTCTCTGTGAAGCATCCCTCCAAAATCAAATTGTATGGAAGATTAAGGAAACAGTGAAGGAATTTTATGGAGAAAATATAAAAGAGTCTCCTGATTATGAAAGGATCATCAATCTTCGTCATTTTAAGAGGATACTAAGTTTGCTTGAAGGACAAAAGATAGCTTTTGGTGGGGAGACTGATGAGGCCACACGCTACATAGCCCCAACAGTACTTACCGATGTTGATCCTAAAACCAAGGTGATGCAAGAAGAAATTTTTGGACCAATTCTTCCAATAGTGCCTGTGAAAAATGTAGATGAGGCCATAAATTTCATAAATGAACGTGAAAAGCCTCTGGCTCTTTATGTATTTTCGCATAACCATAAGCTCATCAAACGGATGATTGATGAGACATCCAGTGGAGGTGTCACAGGCAATGACGTCATTATGCACTTCACGCTCAACTCTTTCCCATTTGGAGGAGTGGGTTCCAGTGGGATGGGAGCTTATCACGGAAAACATAGTTTTGATACTTTTTCTCATCAGCGTCCCTGTTTATTAAAAAGTTTAAAGAGAGAAGGTGCTAACAAACTCAGATATCCTCCCAACAGCCAGTCAAAGGTGGATTGGGGAAAATTTTTTCTCTTGAAACGGTTCAACAAAGAAAAACTCGGTCTCCTGTTGCTCACTTTCCTGGGTATTGTAGCCGCTGTGCTTGTCAAGAAATACCAAGCTGTGCTGAGGAGAAAGGCCCTGTTGATTTTTCTGGTAGTTCACAGACTGCGTTGGTCCAGTAAGCAGAGATGAACACCAGATTTCAAAACCCAGCCCTGTCTGTTAAGAGTGAGGAAGTGAGCAGCGTCTCTGCTTGGCTGCCCATCGTCTGGGATGTG