Transcript asmbl_72688

Sequence
Transcript Sequence for observation asmbl_72688 of TGE0003781:
AGAGCTTTCGAGGAAGGTTTCTTCAACTCAAATTCATCCGCCTGATAATTTTCTTATATTTTCCTAAAGAAGGAAGAGAAGCGCATAGAGGAGAAGGGAAATAATTTTTTAGGAGCCTTTCTTACGGCTATGAGGAATTTGGGGCTCAGTTGAAAAGCCTAAACTGCCTCTCGGGAGGTTGGGCGCGGCGAACTACTTTCAGCGGCGCACGGAGACGGCGTCTACGTGAGGGGTGATAAGTGACGCAACACTCGTTGCATAAATTTGCGCTCCGCCAGCCCGGAGCATTTAGGGGCGGTTGGCTTTGTTGGGTGAGCTTGTTTGTGTCCCTGTGGGTGGACGTGGTTGGTGATTGGCAGGATCCTGGTATCCGCTAACAGGTCAAAATGCAGATCTTCGTGAAAACCCTTACCGGCAAGACCATCACCCTTGAGGTGGAGCCCAGTGACACCATCGAAAATGTGAAGGCCAAGATCCAAGATAAAGAAGGCATCCCCCCCGACCAGCAGAGGCTCATCTTTGCAGGCAAGCAGCTGGAAGATGGCCGCACTCTTTCTGACTACAACATCCAGAAAGAGTCGACCCTGCACCTGGTCCTGCGCCTGAGGGGTGGCTGTTAATTCTTCAGTCATGGCATTCGCAGTGCCCAGTGATGGCATTACTCTGCACTATAGCCATTTGCCCCAACTTAAGTTTAGAAATTACAAGTTTCAGTAATAGCTGAACCTGTTCAAAATGTTAATAAAGGTTTCGTTGCATGGTAGCATACTTGGTGTTTTGTCATGAAATTCTCTAGTGATGTGTGGGTACGCTTAAAACTGGTGAAAATGTTTAGGGATTTAATTTTGAGATTGGTAATGTGCTCAAAGTTAAGTCACTTGACTTTGGTATACACTTGGGTGGGCTGAGGGGCAAGAGCCTTCTTTGCTGTTTAAGTCATTACAAGTTAGGATCCTGGGTAAATGGCAAACTTTCTGAAGCTCGAATTTAAAGTCTGTTGGGAGGCCGAGGCAGGCGGAT