Transcript asmbl_24225

Sequence
Transcript Sequence for observation asmbl_24225 of TGE0000661:
CGCGATAGCTTGTCCGCTTCCCATAACTCCGTGTGCTCGCCCCTCCCGTCCTCTTTCCGCCATCTTTCCGTGCCGCCATAATGGTGCGCATGAACGTCCTGGCCGACGCACTCAAGAGCATCAACAATGCTGAAAAGAGAGGCAAACGCCAGGTTCTCATTAGGCCGTGCTCCAAAGTCATCGTCCGGTTTCTGACTGTGATGATGAAGCATGGTTACATTGGCGAATTTGAAATCATCGATGATCACAGAGCTGGGAAAATTGTTGTGAACCTCACAGGCAGGTTAAACAAGTGTGGAGTGATCAGCCCCAGATTCGACGTGCAACTCAAAGATCTAGAAAAATGGCAGAACAACTTGCTCCCGTCCCGTCAGTTTGGTTTCATTGTACTGACAACTTCAGCGGGCATCATGGACCATGAAGAAGCAAGACGAAAACACACAGGAGGGAAAATCCTGGGATTCTTTTTCTAGGGATGTAATACATTTGTTCAAATAAAATGCCTCAATGGA