Transcript asmbl_72533

Sequence
Transcript Sequence for observation asmbl_72533 of TGE0000723:
GCCCGGTGCACTGTGGACGATGAGTCAGGGTTAGGGGCGCCAGGACGTGGGCGTGCAGGACGCCAGAGCTGGGTCAGAGCTCGAGCCAGCGGCGCCCGGAGAGATTCGGAGATGCAGGCGGCTCGGATGGCCGCGAGCTTGGGGCGGCAGCTGCTGAGGCTCGGGGGCGGAAGCTCGCGGCTCACGGCGCTCCTGGGGCAGCCCCGGCCCGGCCCTGCCCGGCGGCCCTATGCCGGGGGTGCCGCTCAGCTGGCTCTGGACAAGTCAGATTCCCACCCCTCTGACGCTCTGACCAGGAAAAAACCGGCCAAGGCGGTAGGTAGCCCCGAGGCCAGGTGGACCTTAGCCAGACCCAACCAGAGCCCTGAAATTTGCCTCTCTCTGCCCAGGAATCTAAGTCCTTTGCTGTGGGAATGTTCAAAGGCCAGCTCACCACAGATCAGGTGTTCCCATACCCGTCCGTGCTCAACGAAGAGCAGACACAGTTTCTTAAAGAGCTGGTGGAGCCTGTGTCCCGTTTCTTCGAGGAAGTGAACGATCCCGCCAAGAATGACGCTCTGGAGATGGTGGAGGAGACCACTTGGCAGGGCCTCAAGGAGCTGGGGGCCTTTGGTCTGCAAGTGCCCAGTGAGCTGGGTGGTGTGGGCCTTTGCAACACCCAGTACGCCCGTTTGGTGGAGATCGTGGGCATGCATGACCTTGGCGTGGGCATTACCCTGGGGGCCCATCAGAGCATCGGTTTCAAAGGCATCCTGCTCTTTGGCACAAAGGCCCAGAAAGAAAAATACCTCCCCAAGCTGGCATCTGGGGAGACTGTGGCCGCTTTCTGTCTAACCGAGCCCTCAAGCGGGTCAGATGCAGCCTCCATCCGAACCTCTGCTGTGCCCAGCCCCTGTGGAAAATACTATACCCTCAATGGAAGCAAGCTTTGGATCAGTAATGGGGGCCTAGCAGACATCTTCACGGTCTTTGCCAAGACACCAGTTACAGATCCAGCCACAGGAGCCGTGAAGGAGAAGATCACAGCTTTTGTGGTGGAGAGGGGCTTCGGGGGCATTACCCATGGGCCCCCTGAGAAGAAGATGGGCATCAAGGCTTCAAACACAGCAGAGGTGTTCTTTGATGGAGTACGGGTGCCATCGGAGAACGTGCTGGGTGAGGTTGGGAGTGGCTTCAAGGTTGCCATGCACATCCTCAACAATGGAAGGTTTGGCATGGCTGCGGCCCTGGCAGGTACCATGAGAGGCATCATTGCTAAGGCGGTAGATCATGCCACTAATCGTACCCAGTTTGGGGAGAAAATTCACAACTTTGGGCTGATCCAGGAGAAGCTGGCACGGATGGTTATGCTGCAGTATGTAACTGAGTCCATGGCTTACATGGTGAGTGCTAACATGGACCAGGGAGCCACGGACTTCCAGATAGAGGCCGCCATCAGCAAAATCTTTGGCTCGGAGGCAGCCTGGAAGGTGACAGATGAATGCATCCAAATCATGGGGGGTATGGGCTTCATGAAGGAACCTGGAGTAGAGCGTGTGCTCCGAGATCTTCGCATCTTCCGGATCTTTGAGGGGACAAATGACATTCTTCGGCTGTTTGTGGCTCTGCAGGGCTGTATGGACAAAGGAAAGGAGCTCTCTGGGCTTGGCAGTGCTCTAAAGAATCCCTTTGGGAATGCTGGCCTCCTGCTAGGAGAGGCAGGCAAACAGCTGAGGCGGCGGGCAGGGCTGGGCAGCGGCCTGAGTCTCAGCGGACTTGTCCACCCGGAGTTGAGTCGGAGTGGCGAGCTGGCAGTACGGGCTCTGGAGCAGTTTGCCACTGTGGTGGAGGCCAAGCTGATAAAACACAAGAAGGGGATTGTCAATGAACAGTTTCTGCTGCAGCGGCTGGCAGACGGGGCCATCGACCTCTATGCCATGGTGGTGGTTCTCTCGAGGGCCTCAAGATCCCTGAGTGAGGGCCACCCCACGGCCCAGCATGAGAAAATGCTCTGTGACACCTGGTGTATCGAGGCTGCAGCTCGGATCCGAGAGGGCATGGCCGCCCTGCAGTCTGACCCCTGGCAGCAAGAGCTCTACCGCAACTTCAAAAGCATCTCCAAGGCCTTGGTGGAGCGGGGTGGTGTGGTCACCAGCAACCCACTTGGCTTCTGAATACTCCCGGCCAGGGCCTGTCCCAGTTATGTGCCTTCCCTCAAGCCAAAGCCGAAGCCCCTTTCCTTAAGGCCCTGGTTTGTCCCGAAGGGGCCTAGTGTTCCCAGCACTGTGCCTGCTCTCAAGAGCACTTACTGCCTCGCAAATAATAAAAATTTCTAGCCAGTCA