Transcript asmbl_72529

Sequence
Transcript Sequence for observation asmbl_72529 of TGE0000722:
GCCCGGTGCACTGTGGACGATGAGTCAGGGTTAGGGGCGCCAGGACGTGGGCGTGCAGGACGCCAGAGCTGGGTCAGAGCTCGAGCCAGCGGCGCCCGGAGAGATTCGGAGATGCAGGCGGCTCGGATGGCCGCGAGCTTGGGGCGGCAGCTGCTGAGGCTCGGGGGCGGAAGCTCGCGGCTCACGGCGCTCCTGGGGCAGCCCCGGCCCGGCCCTGCCCGGCGGCCCTATGCCGGGGGTGCCGCTCAGCTGGCTCTGGACAAGTCAGATTCCCACCCCTCTGACGCTCTGACCAGGAAAAAACCGGCCAAGGCGGAATCTAAGTCCTTTGCTGTGGGAATGTTCAAAGGCCAGCTCACCACAGATCAGGTGTTCCCATACCCGTCCGTGCTCAACGAAGAGCAGACACAGTTTCTTAAAGAGCTGGTGGAGCCTGTGTCCCGTTTCTTCGAGGAAGTGAACGATCCCGCCAAGAATGACGCTCTGGAGATGGTGGAGGAGACCACTTGGCAGGGCCTCAAGGAGCTGGGGGCCTTTGGTCTGCAAGTGCCCAGTGAGCTGGGTGGTGTGGGCCTTTGCAACACCCAGTACGCCCGTTTGGTGGAGATCGTGGGCATGCATGACCTTGGCGTGGGCATTACCCTGGGGGCCCATCAGAGCATCGGTTTCAAAGGCATCCTGCTCTTTGGCACAAAGGCCCAGAAAGAAAAATACCTCCCCAAGCTGGCATCTGGGGAGACTGTGGCCGCTTTCTGTCTAACCGAGCCCTCAAGCGGGTCAGATGCAGCCTCCATCCGAACCTCTGCTGTGCCCAGCCCCTGTGGAAAATACTATACCCTCAATGGAAGCAAGCTTTGGATCAGTAATGGGGGCCTAGCAGACATCTTCACGGTCTTTGCCAAGACACCAGTTACAGATCCAGCCACAGGAGCCGTGAAGGAGAAGATCACAGCTTTTGTGGTGGAGAGGGGCTTCGGGGGCATTACCCATGGGCCCCCTGAGAAGAAGATGGGCATCAAGGCTTCAAACACAGCAGAGGTGTTCTTTGATGGAGTACGGGTGCCATCGGAGAACGTGCTGGGTGAGGTTGGGAGTGGCTTCAAGGTTGCCATGCACATCCTCAACAATGGAAGGTTTGGCATGGCTGCGGCCCTGGCAGGTACCATGAGAGGCATCATTGCTAAGGCGGTAGATCATGCCACTAATCGTACCCAGTTTGGGGAGAAAATTCACAACTTTGGGCTGATCCAGGAGAAGCTGGCACGGATGGTTATGCTGCAGTATGTAACTGAGTCCATGGCTTACATGGTGAGTGCTAACATGGACCAGGGAGCCACGGACTTCCAGATAGAGGCCGCCATCAGCAAAATCTTTGGCTCGGAGGCAGCCTGGAAGGTGACAGATGAATGCATCCAAATCATGGGGGGTATGGGCTTCATGAAGGAACCTGGAGTAGAGCGTGTGCTCCGAGATCTTCGCATCTTCCGGATCTTTGAGGGGACAAATGACATTCTTCGGCTGTTTGTGGCTCTGCAGGGCTGTATGGACAAAGGAAAGGAGCTCTCTGGGCTTGGCAGTGCTCTAAAGAATCCCTTTGGGAATGCTGGCCTCCTGCTAGGAGAGGCAGGCAAACAGCTGAGGCGGCGGGCAGGGCTGGGCAGCGGCCTGAGTCTCAGCGGACTTGTCCACCCGGAGTTGAGTCGGAGTGGCGAGCTGGCAGTACGGGCTCTGGAGCAGTTTGCCACTGTGGTGGAGGCCAAGCTGATAAAACACAAGAAGGGGATTGTCAATGAACAGTTTCTGCTGCAGCGGCTGGCAGACGGGGCCATCGACCTCTATGCCATGGTGGTGGTTCTCTCGAGGGCCTCAAGATCCCTGAGTGAGGGCCACCCCACGGCCCAGCATGAGAAAATGCTCTGTGACACCTGGTGTATCGAGGCTGCAGCTCGGATCCGAGAGGGCATGGCCGCCCTGCAGTCTGACCCCTGGCAGCAAGAGCTCTACCGCAACTTCAAAAGCATCTCCAAGGCCTTGGTGGAGCGGGGTGGTGTGGTCACCAGCAACCCACTTGGCTTCTGAATACTCCCGGCCAGGGCCTGTCCCAGTTATGTGCCTTCCCTCAAGCCAAAGCCGAAGCCCCTTTCCTTAAGGCCCTGGTTTGTCCCGAAGGGGCCTAGTGTTCCCAGCACTGTGCCTGCTCTCAAGAGCACTTACTGCCTCGCAAATAATAAAAATTTCTAGCCAGTCA