Transcript asmbl_72390

Sequence
Transcript Sequence for observation asmbl_72390 of TGE0058202:
GGTCGCTTTAAGAAAGGAGTAGCTGTAATCTGAAGCCTGCTGGACGCTGGATTAGAAGGCAGCAAAAAAAGCTCTGTGCTGGCTGGAGCCCCCTCAGTGTGCAGGCTTAGAGGGACTAGGCTGGGTGTGGAGCTGCAGCGTATCCACAGGCCCCAGGATGCAGGCCCTGGTGCTACTCCTCTGCATTGGAGCCCTCCTCGGGCACAGCAGCTGCCAGAACCCTGCCAGCCCCCCGGAGGAGGGCTCCCCAGACCCCGACAGCACAGGGGCGCTGGTGGAGGAGGAGGATCCTTTCTTCAAAGTCCCCGTGAACAAGCTGGCAGCGGCTGTCTCCAACTTCGGCTATGACCTGTACCGGGTGCGATCCAGCACGAGCCCCACGACCAACGTGCTCCTGTCTCCTCTCAGTGTGGCCACGGCCCTCTCGGCCCTCTCGCTGGGAGCGGAGCAGCGAACAGAATCCATCATTCACCGGGCTCTCTACTATGACTTGATCAGCAGCCCAGACATCCATGGTACCTATAAGGAGCTCCTTGACACGGTCACTGCCCCCCAGAAGAACCTCAAGAGTGCCTCCCGGATCGTCTTTGAGAAGAAGCTGCGCATAAAATCCAGCTTTGTGGCACCTCTGGAAAAGTCATATGGGACCAGGCCCAGAGTCCTGACGGGCAACCCTCGCTTGGACCTGCAAGAGATCAACAACTGGGTGCAGGCGCAGATGAAAGGGAAGCTCGCCAGGTCCACAAAGGAAATTCCCGATGAGATCAGCATTCTCCTTCTCGGTGTGGCGCACTTCAAGGGGCAGTGGGTAACAAAGTTTGACTCCAGAAAGACTTCCCTCGAGGATTTCTACTTGGATGAAGAGAGGACCGTGAGGGTCCCCATGATGTCGGACCCTAAGGCTGTTTTACGCTATGGCTTGGATTCAGATCTCAGCTGCAAGATTGCCCAGCTGCCCTTGACCGGAAGCATGAGTATCATCTTCTTCCTGCCCCTGAAAGTGACCCAGAATTTGACCTTGATAGAGGAGAGCCTCACCTCCGAGTTCATTCATGACATAGACCGAGAACTGAAGACCGTGCAGGCGGTCCTCACTGTCCCCAAGCTGAAGCTGAGTTATGAAGGCGAAGTCACCAAGTCCCTGCAGGAGATGAAGCTGCAATCCTTGTTTGATTCACCAGACTTTAGCAAGATCACAGGCAAACCCATCAAGCTGACTCAGGTGGAACACCGGGCTGGCTTTGAGTGGAACGAGGATGGGGCGGGAACCACCCCCAGCCCAGGGCTGCAGCCTGCCCACCTCACCTTCCCGCTGGACTATCACCTTAACCAGCCTTTCATCTTCGTACTGAGGGACACAGACACAGGGGCCCTTCTCTTCATTGGCAAGATTCTGGACCCCAGGGGCCCCTAATATCCCAGTTTAATATTCCAATACCCTAGAAGAAAACCCGAGGGACAGCAGATTCCACAGGACACGAAGGCTGCCCCTGTAAGGTTTCAATGCATACAATAAAAGAGCTTTATCCCTAA