Transcript asmbl_6977

Sequence
Transcript Sequence for observation asmbl_6977 of TGE0058686:
TGGTAACTTTATTAATAACAATAGCATCTATACACATTTGAAAACACACATGTAGGAGACAGTTAAGATCTATTCAGTCTGTGATAATGTCTAGAGCTCATTTGGATTCATCAAACCCCTGCCATCAGCTCCAAAAGCCCTTAGCCAAAAACAGCTGAATCACTCATCAAACCATCAGTGTCTTCCTCGGCAGAATCAAGGGTTGGACAGAAAGAGTAAATATTCTGCACCTCCACAAAATAAAACTAAAATGCAATTGTCCTGCATCTGAGAATACAAGGGTGGACAGTATGAGCTGCATGACTGTGAACCAATGAGGCTTCTCTTGGCCTCATTTGTAAAAAGGAGATTAACTCTGTAGTCCCGCCTATATTGCATGGCCTCCAGAAAAGCAAATGAGGTGGTAAGTGTAAATTAAAAGCTCCTCTCCTTTAAGAGGGGAACACCATGAGGGGAGAGTAAGAAAAGGAGAAGGAAAAGGCTCTTTCCAGTGACCAACACGCTGAATTTGATGAAAATCCATAAGAGGTTATGCTAAACTGAGAAGCATAAGGGTGGATCTACCATTGCCACCTCCTCTTTGTAGCAAAAAAAATCTTAACACGGCCCCCTCCCAGCTGTTGCACTGAGGTGACTAAGGATACATTTTGAGGAAGTAGCTCCAAGAACATTTCCATTTTCACTGTGCCTTCACATACATCTAATGGAAATGAACAGCACCCTTCATCCATCCACGGAAGCGATTAAGAAAAGGGTGGGATGGAAAAATTAACCCAACAATATTAGATCAATACGTAGTATTTAAGTGTCCATAATGTGCCAGGCTGAAGATGCACGGGAAAACCACACTAGCCGGTCTGTCAAGGGCTTGAGAATACCATAAACAAGAAAACAGACGAACCAATTTCAGACAGCTGCTAGAAGGAAGATAAAATGAGACAGGCAAGTATGAGAGGCGCGAATTCCTGAGTGGATGACGTAGGTCTCTGAGAGGTGACTTTTGAGCCCGTATCTACATGGTAAGTGCCTCGCAGTGACCTGGGGCCGTAGCGTTACCATTTAAAGCACAGACCATTAAATGCAGAAATTATCAACAAAATGAGAAATAGGAATTTCAAAGTCTCAAAGTGAACGACGGAAACTGAAATCTACAAATTAGAAAAAGGCGCAGAATTTTGAATATTCTTGTCGCCCAATCAGGACAAGGCTGGGACCCGGCTGCGCGGCCTTCGTCCAAAATACACAGAACGGCTGGTATCCACAGGAGGCCCCATCGCACGGCAGAACTGGTGACCGGACACAAAAGCTGCTGCCAAGCGTCAGTCATACAGAGCTGTCACGCAGTGTTTGCGGAACCCGGGCTGAATTGTGTCCTGGAGTTCTCTTAAATGACAGCCGAACTCAGCCACTTCGTTTTAGAATGAAACAGACCCAAGGAGCCACCAGGGCGCGTGTGGGGCGGGAGTGGGGGCGGGTAAAGAGGCGGATTCCCAACAGCCTAATTGAGAACCGACTCCTGGGAAGGCTAAGCAGCACAATGAGTAAAGACACGCTCTAGATTCAAAAGCAAATCCAATGACGCACTGGGGACCTCGAGTTCCAAATAGTTAAAAAGCTACGTATGCCATTTCCCATGACCTTCACACTAAAATAACTTACTTTATGAAAAGAAACTAAGGGAATAAGTGAACAAGCTCTTTTCTAGTGATTAGGTGGGTGGCTCTGAAAAGAGCCTTTGGAGTCAAGCAGCCGGCGACTCGAGCGAGCGAGCGCCAGGTCCCGGCAGGGACTCACTTGGAGCTGGTGTACTTGGTGACCGCCTTGGTGCCCTCGGACACGGCGTGCTTGGCCAGCTCGCCGGGCAGCAGCAGGCGCACGGCCGTCTGGATCTCGCGGGATGTGATGGTGGAGCGCTTGTTGTAGTGCGCCAGGCGGGAAGCCTCTCCCGCGATGCGCTCGAAGATGTCGTTGACGAAGGAGTTCATGATGCCCATGGCCTTGGACGAGATGCCGGTGTCGGGGTGGACCTGCTTCAGCACCTTGTACACGTAGATGGAGTAGCTCTCTTTGCGGCTGCGCTTGCGCTTCTTGCCGTCTTTCTTCTGGGCTTTGGTGACGGCTTTCTTGGAGCCCTTTTTAGGGGCCGGAGCGGATTTTGCCGGTTCAGGCATGGTAAGACACAGTACAAACGCGGCTTAGCCAAGAAAAGAAGTAAGAGAATGGGCGGGCCTGATTCTTTTATAACCACCTTATGCAAATTAG