Transcript asmbl_6967

Sequence
Transcript Sequence for observation asmbl_6967 of TGE0000511:
TGGGTGGCTCTGAAAAGAGCCTTTTGAGTTCACAGGTGCCCCTTCGAGACGCGGGCCGGGCTGGGCCCACTTGGGCCGGACGTCAGCCTCACTTGCCCTTTGCCTTGTGGTGACTCTCCGTCTTCTTAGGGAGCAGTACGGCCTGGATGTTAGGCAAGACGCCGCCCTGGGCGATGGTGACTTTGCCCAGCAGCTTGTTCAGTTCCTCGTCGTTGCGGATGGCCAGCTGGAGGTGACGAGGGATGATGCGCGTCTTCTTGTTGTCCCGAGCCGCGTTGCCCGCCAGCTCCAGGATCTCGGCGGTCAGATACTCGAGGACCGCAGCCATGTAGACGGGCGCGCCGGCCCCCACTCGCTCCGCGTAGTTGCCTTTGCGCAGCAAGCGATGCACTCGCCCTACCGGGAACTGAAGGCCAGCGCGGGACGAGCGCGACTTGGCCTTGGCGCGGGCCTTGCCTCCTTGCTTGCCACGACCAGACATGACAGCGATAGTAGTCACCGAGAGAAACTCCTGCCTGGCGATCGGGAAAGTCGCCGAAAACGCCGCTGCTTCACCTTTTTATAGACAGAACGGCGATTGTCCACGGAGCACTTTGATTGGCTCAAGCAAATTTTGTCCCGATAGCCAATAGGATAGCTCAGCCAGAATCCACTCATTTACATAATCTC