Transcript asmbl_68801

Sequence
Transcript Sequence for observation asmbl_68801 of TGE0058685:
TCGCCCTGGATGCTCTGCACTGCGCCCTCCATCTCCGCCTGCCGCTCCTCCAGCTGTGCTTGAGTCAGCTGGATCTGGTCTACGGCCCCGATGATTTTGTCCAGGAGGCTCAGCACCAGCACGCCGTTCACCTGGTCCGACTTGATCAGCTCTTCTGAGCCGGCCCCCGACGGCTCCTCCGCTGCCTGAGCCCCAGCGGAGGAAGGCTCCGGGGCCTCGGCGTCGGGGTACCCGGGAAGCGGCCGCTCGACAATATAGAGCGTGGGGTCCTCCATGGCTACCCGGAGCCGTGCGGGACCGGCCGGGTGGGGCTGGAGCTGGAGCGGGAGACCCGGAGAGAAGCAGGAGCGGAAGGGAGGAGAGCTAGCGGGCGAGAGCGGAGAGCAGAGGAAACTCGAGCCACGTCCGTGCGCACCGGGACAGCGGCCAGAACTGCT