Transcript asmbl_65506

Sequence
Transcript Sequence for observation asmbl_65506 of TGE0058684:
GCTTGACGATGAAATCGCTCAGAAGAACAATGCCCTGAAGAAGATCCGGGAGCTGGAGGGCCACATCTCAGACCTCCAGGAGGACCTGGACTCAGAGCGGGCCGCCAGGAACAAGGCTGAAAAGCAGAAGCGAGACCTCGGCGAGGAGCTGGAGGCCCTAAAGACAGAGCTGGAAGACACACTGGACAGCACAGCCACTCAGCAGGAGCTCAGGGCCAAGAGGGAGCAGGAGGTGACGGTGCTGAAGAAGGCCCTGGATGAAGAGACGCGGTCCCATGAGGCTCAGGTCCAGGAGATGAGGCAGAAACACGCACAGGCGGTGGAGGAGCTCACAGAGCAGCTTGAGCAGTTCAAGAGGGCCAAGGCGAACCTAGACAAGAATAAGCAGACGCTGGAGAAAGAGAACGCAGACCTGGCCGGGGAGCTGCGGGTCCTGGGCCAGGCCAAGCAGGAGGTGGAACATAAGAAGAAGAAGCTGGAGGCGCAGGTGCAGGAGCTGCAGTCCAAGTGCAGCGATGGGGAGCGGGCCCGGGCGGAGCTCAATGACAAAGTCCACAAGCTGCAGAATGAAGTTGAGAGCGTCACAGGGATGCTTAACGAGGCCGAGGGGAAGGCCATTAAGCTGGCCAAGGACGTGGCGTCCCTCAGTTCCCAGCTCCAGGACACCCAGGAGCTGCTTCAAGAAGAAACCCGGCAGAAGCTCAACGTGTCTACGAAGCTGCGCCAGCTGGAGGAGGAGCGGAACAGCCTGCAAGACCAGCTGGACGAGGAGATGGAGGCCAAGCAGAACCTGGAGCGCCACATCTCCACTCTCAACATCCAGCTCTCCGACTCGAAGAAGAAGCTGCAGGACTTTGCCAGCACCGTGGAAGCTCTGGAAGAGGGGAAGAAGAGGTTCCAGAAGGAGATCGAGAACCTCACCCAGCAGTACGAGGAGAAGGCGGCCGCTTATGATAAACTGGAAAAGACCAAGAACAGGCTTCAGCAGGAGCTGGACGACCTGGTTGTTGATTTGGACAACCAGCGGCAACTCGTGTCCAACCTGGAAAAGAAGCAGAGGAAATTTGATCAGTTGTTAGCCGAGGAGAAAAACATCTCTTCCAAATACGCGGATGAGAGGGACAGAGCTGAGGCAGAAGCCAGGGAGAAGGAAACCAAGGCCCTGTCCCTGGCTCGGGCCCTTGAAGAGGCCTTGGAAGCCAAAGAGGAACTCGAGCGGACCAACAAAATGCTCAAAGCCGAAATGGAAGACCTGGTCAGCTCCAAGGATGACGTGGGCAAGAACGTCCATGAGCTGGAGAAGTCCAAGCGGGCCCTGGAGACCCAGATGGAGGAGATGAAGACGCAGCTGGAAGAGCTGGAGGACGAGCTGCAAGCCACGGAGGACGCCAAACTGCGGCTGGAAGTCAACATGCAGGCGCTCAAGGGCCAGTTCGAAAGGGATCTCCAAGCCCGGGACGAGCAGAATGAGGAGAAGAGGAGGCAACTGCAGAGACAGCTTCACGAGTATGAGACGGAACTGGAAGACGAGCGAAAGCAACGTGCCCTGGCAGCTGCAGCAAAGAAGAAGCTGGAAGGGGACCTGAAAGACCTGGAGCTTCAGGCCGACTCTGCCATCAAGGGGAGGGAGGAAGCCATCAAGCAGCTACGCAAACTGCAGGCTCAGATGAAGGACTTTCAAAGAGAGCTGGAAGATGCCCGTGCCTCCAGAGATGAGATCTTTGCCACAGCCAAAGAGAATGAGAAGAAAGCCAAGAGCTTGGAAGCAGACCTCATGCAGCTACAAGAGGACCTCGCCGCCGCTGAGAGGGCTCGCAAACAAGCGGACCTCGAGAAGGAGGAACTGGCAGAGGAGCTGGCCAGTAGCCTGTCGGGAAGGAACGCACTCCAGGACGAGAAGCGCCGCCTGGAGGCCCGGATCGCCCAGCTGGAGGAGGAGCTGGAGGAGGAGCAGGGCAACATGGAGGCCATGAGCGACCGGGTCCGCAAAGCCACACAGCAGGCCGAGCAGCTCAGCAACGAGCTGGCCACAGAGCGCAGCACGGCCCAGAAGAATGAGAGTGCCCGGCAGCAGCTCGAGCGGCAGAACAAGGAGCTCCGGAGCAAGCTCCACGAGATGGAGGGGGCCGTCAAGTCCAAGTTCAAGTCCACCATCGCGGCGCTGGAGGCCAAGATTGCACAGCTGGAGGAGCAGGTCGAGCAGGAGGCCAGAGAGAAACAGGCGGCCACCAAGTCGCTGAAGCAGAAAGACAAGAAGCTGAAGGAAATCTTGCTGCAGGTGGAGGACGAGCGCAAGATGGCCGAGCAGTACAAGGAGCAGGCAGAGAAAGGCAATGCCAGGGTCAAGCAGCTCAAGAGGCAGCTGGAGGAGGCAGAGGAGGAGTCCCAGCGCATCAACGCCAACCGCAGGAAGCTGCAGCGGGAGCTGGATGAGGCCACGGAGAGCAACGAGGCCATGGGCCGCGAGGTGAACGCACTCAAGAGCAAGCTCAGAGGGCCCCCCCCACAGGAAACTTCGCAGTGATGCACCAGGCGAGGAAACGAGACCTCTTTCGTTCCTTCTAGAAGGTCTGGAGGACGTAGAGTTATTGAAAATGCAGATGGTTCTGAGGAGGAAACGGACACTCGAGACGCAGACTTCAATGGAACCAAGGCCAGTGAATAAGCAACTTTCTACAGTTTTGCACCACGGCAAGAAAACCAAAAACCAAAACAAACAAACAAAAAAAACCCAACAACAACCCAGAACAAAGCAAAACCCAGCAGACTGTACTTAGCATTGTCTAAATCCATTCTCAAATTCCAAATATCACAGACACCCCTCACACAAGGAATATAAAAACCACCACCCTCCAGCCTGGGCAACGTAGTAAAACCTCATCTATACAAGAATTTAAAAATAAGCTGGGCGTGGTGGTACACACCTGTGGTCCCAGCTACTAGGGAGGCTGAG