Transcript asmbl_60813

Sequence
Transcript Sequence for observation asmbl_60813 of TGE0000627:
GTTTTCCTGCGCAGGAGGTGAGGGAGACTGGGTCCTGGCCTTTGGGCATCATCCAGCGCCATCGGCCTGGCGCTTCAGCCAACGCGGGAGTGGATGGGCCCCTTCTTCTTCGCAGACAGCGTTCGGCCGCTGCCCGGGCTCTAGGCGCGGCCGGACGGCCCAGTCTGGAGGGTTCGGGGCGGAGGCCCGGGGGGGTGCGCGCGCCCGGGGTCCGGCCTCTCACTCGCTCCCCTCTCGTCCGCAGCCGCAGGGCCGTAGGCAGCCATGGCGCCCAGCCGGAATGGCATGGTCTTGAAGCCCCACTTCCACAAGGACTGGCAGCGGCGCGTGGCCACGTGGTTCAACCAGCCGGCCCGTAAGATCCGCAGACGTAAGGCCCGGCAAGCCAAGGCGCGCCGCATCGCCCCGCGCCCCGCGTCGGGTCCCATCCGGCCCATCGTGCGCTGCCCCACGGTTCGGTACCACACGAAGGTGCGCGCCGGCCGCGGCTTCAGCCTGGAGGAGCTCAGGGTGGCCGGCATTCACAAGAAGGTGGCCCGGACCATCGGCATTTCTGTGGATCCGAGGAGGCGGAACAAGTCCACGGAGTCCCTGCAGGCCAACGTGCAGCGGCTGAAGGAGTACCGCTCCAAACTCATCCTCTTCCCCAGGAAGCCCTCGGCCCCCAAGAAGGGAGACAGTTCTGCTGAAGAACTGAAACTGGCCACCCAGCTGACCGGACCGGTCATGCCCGTCCGGAACGTCTATAAGAAGGAGAAAGCTCGAGTCATCACTGAGGAAGAGAAGAATTTCAAAGCCTTCGCTAGTCTCCGTATGGCCCGTGCCAACGCCCGGCTCTTCGGCATACGGGCAAAAAGAGCCAAGGAAGCCGCAGAACAGGATGTTGAAAAGAAAAAATAAAGCCCTCCTGGGGACTTGGAATCAGTCGGCAGTCATGCTGGGTCTCCACGTGGTGTGTTTCGTGGGAACAACTGGGCCTGGGATGGGGCTTCACTGCTGTGACTTCCTCCTGCCAGGGGATTTGGGGCTTTCTTGAAAGACAGTCCAAGCCCTGGATAATGCTTTACTTTCTGTGTTGAAGCACTGTTGGTTGTTTGGTTAGTGACTGATGTAAAACGGTTTTCTTGTGGGGAGGTTACAGAGGCTGACTTCAGAGTGGACTTGTGTTTTTTCTTTTTAAAGAGGCAAGGTTGGGCTGGTGCTCACAGCTGTAATCCCAGCACTTTGAGGTTGGCTGGGAGTTCAAGACCAGCCTGGCCAACATG