Transcript asmbl_58865

Sequence
Transcript Sequence for observation asmbl_58865 of TGE0058680:
GAGGAATGCGGTCGCCCCCTTGGGAAAGTACATATCTGGGAGAAGCAGGCGGCTCCGCGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAGGGCCCCTCGCCGCCGCCACCATGGACGCCATCAAGAAGAAGATGCAGATGCTGAAGCTCGACAAGGAGAACGCCTTGGATCGAGCTGAGCAGGCGGAGGCCGACAAGAAGGCGGCGGAAGACAGGAGCAAGCAGCTCGAGGAGGACATCGCGGCCAAGGAGAAGTTGCTGCGGGTGTCGGAGGACGAGCGGGACCGGGTGCTGGAGGAGCTGCACAAGGCGGAGGACAGCCTCCTGGCCGCCGAAGAGGCCGCCGCCAAGGCTGAAGCCGACGTAGCTTCTCTGAACAGACGCATCCAGCTGGTTGAGGAAGAGTTGGATCGTGCCCAGGAGCGTCTGGCAACAGCTTTGCAGAAGCTGGAGGAAGCTGAGAAGGCAGCAGATGAGAGTGAGAGAGGCATGAAAGTCATTGAGAGTCGAGCCCAAAAAGATGAAGAAAAAATGGAAATTCAGGAGATCCAACTGAAAGAGGCCAAGCACATTGCTGAAGATGCCGACCGCAAATATGAAGAGGTGGCCCGTAAGCTGGTCATCATTGAGAGCGACCTGGAACGTGCAGAGGAGCGGGCTGAGCTCTCAGAAGGGTAAGCGGGCCCGGCGCCAGGAGGCCACGAATGGGGTGCTGCAGAGCAGTGACTAAACAGCATGACCTTCTGGCAGCTGCACATTACCTGTTTCAGCTCCGGGCTCCTTTTGTGCTCATTTGATGTGGATGAGCCACGAGTATGGAACATGGAGGACTCGTGTGGGGTGTCTTATGTATGAATGCGTGTATCACTGCATGCCTTACCTGCACACTGATTTTGTGAATGGCCTTGTGCATTTCCTGTGTCCACTAACAGCCAAGTCCGACAGCTGGAAGAACAATTAAGAATAATGGATCAGACCTTGAAAGCATTAATGGCTGCAGAGGATAAGTACTCGCAGAAGGAAGACAGATATGAGGAAGAGATCAAGGTCCTTTCCGACAAGCTGAAGGAGGCTGAGACTCGGGCTGAGTTTGCGGAGAGGTCAGTAACTAAATTGGAGAAAAGCATTGATGACTTAGAAGAGAAAGTGGCTCATGCCAAAGAAGAAAACCTTAGTATGCATCAGATGCTGGATCAGACTTTACTGGAGTTAAACAACATGTGAAAACCTCCTTAGCTGCGACCACATTCTTTCGTTTTGTTTTGTTTTGTTTTTAAACACCTGCTTACCCCTTAAATGCAATTTATTTACTTTTACCACTGTCACAGAAACATCCACAAGATACCAGCTAGGTCAGGGGGTGGGGAAAACACATACAAAAAGGCAAGCCCATGTCAGGGCGATCCTGGTTCAAATGTGCCATTTCCCGGGTTGATGCTGCCACACTTTGTAGAGAGTTTAGCAACACAGTGTGCTTAGTCAGCGTAGGAATCCTCACTAAAGCAGAAGAAGTTCCATTCAAAGTGCCAATGATAGAGTCAACAGGAAGGTTAATGTTGGAAACACAATCAGGTGTGGATTGGTGCTACTTTGAACAAAAGGTCCCCCTGTGGTCTTTTGTTCAACATTGTACAATGTAGAACTCTGTCCAACACTAATTTATTTTGTCTTGAGTTTTACTACAAGATGAGACTATGGATCCCGCATGCCTGAATTCACTAAAGCCAAGGGTCTGTAAGCCACGCTGCTCTTCCGAGACTTCCATTCCTTTCTGATTGGCACACGTGCAGCTCATGACAATCTGTAGGATAACAATCAGTGTGGATTTCCACTCTTTTCAGTCCTTCATGTTAAAGATTTAGACACCACATACAACTGGTAAAGGACGTTTTCTTGAGAGTTTTAACTATATGTAAACATTGTATAATGATATGGAATAAAATGCACATTGTAGGAC