Transcript asmbl_58864

Sequence
Transcript Sequence for observation asmbl_58864 of TGE0058680:
GAGGAATGCGGTCGCCCCCTTGGGAAAGTACATATCTGGGAGAAGCAGGCGGCTCCGCGCTCGCACTCCCGCTCCTCCGCCCGACCGCGCGCTCGCCCCGCCGCTCCTGCTGCAGCCCCAGGGCCCCTCGCCGCCGCCACCATGGACGCCATCAAGAAGAAGATGCAGATGCTGAAGCTCGACAAGGAGAACGCCTTGGATCGAGCTGAGCAGGCGGAGGCCGACAAGAAGGCGGCGGAAGACAGGAGCAAGCAGCTCGAGGAGGACATCGCGGCCAAGGAGAAGTTGCTGCGGGTGTCGGAGGACGAGCGGGACCGGGTGCTGGAGGAGCTGCACAAGGCGGAGGACAGCCTCCTGGCCGCCGAAGAGGCCGCCGCCAAGGCTGAAGCCGACGTAGCTTCTCTGAACAGACGCATCCAGCTGGTTGAGGAAGAGTTGGATCGTGCCCAGGAGCGTCTGGCAACAGCTTTGCAGAAGCTGGAGGAAGCTGAGAAGGCAGCAGATGAGAGTGAGAGAGGCATGAAAGTCATTGAGAGTCGAGCCCAAAAAGATGAAGAAAAAATGGAAATTCAGGAGATCCAACTGAAAGAGGCCAAGCACATTGCTGAAGATGCCGACCGCAAATATGAAGAGGTGGCCCGTAAGCTGGTCATCATTGAGAGCGACCTGGAACGTGCAGAGGAGCGGGCTGAGCTCTCAGAAGGGTAAGCGGGCCCGGCGCCAGGAGGCCACGAATGGGGTGCTGCAGAGCAGTGACTAAACAGCATGACCTTCTGGCAGCTGCACATTACCTGTTTCAGCTCCGGGCTCCTTTTGTGCTCATTTGATGTGGATGAGCCACGAGTATGGAACATGGAGGACTCGTGTGGGGTGTCTTATGTATGAATGCGTGTATCACTGCATGCCTTACCTGCACACTGATTTTGTGAATGGCCTTGTGCATTTCCTGTGTCCACTAACAGCCAAGTCCGACAGCTGGAAGAACAATTAAGAATAATGGATCAGACCTTGAAAGCATTAATGGCTGCAGAGGATAAGGTACTGATGGCTCGTGTGGTTTTTAGGTTTAACTGCAACCCAGACATCTTTCAGCTTCCAATGCCTCCTGGTTCGTTTGGTATAACGACTGCACCTTCACTTCACCCTCTGCTATTTATATCTTGCCTTAAGTGCTTTCCCTTGGTCCTTTATGCTCCTTTGTTTTCCCTTCATAAATGCTCTTTGGGCAGCCAAAAAAGGAGCCAAATTATCGCACTTCAAAGTTGTTGGATTTGGTCACCCTGCCTTCTGCTGTTGCGAGGTTGGGGGGCAGTGTTCCTGGAAAACCTAAACATTTTAATACCTGATGATTTGGCTACTTTAAGGCAGCCCTTCGTCTCTAGGACTCAGTTTTCATTTTTTCCCATCCCTCTCCTTTTTCTCTCCTCCTTCCTTTGGCTTGTCTCCCACCCTTTCTGCCTCTGATCGAAAACATTAGCAAATGTGCCGAGCTTGAAGAAGAATTGAAAACTGTGACGAACAACTTGAAGTCACTGGAGGCTCAGGCTGAGAAGGTAGGCCAGGAGGATGGTGTGGGGGAAAGGCATCTTTTAAGAGCTGCTCAAAAGAGGCCCTGCCAGAAAGCAACACTTACAGTAGACATTTTAGTAAAATGGCAATATTGTGAGGTGATTTTTGGAGAGTTACTAGATAACAAATTCTTTTTTTTAACTAGAGAATTTATTTTATGTTAGGGATATGAGGCATCAATTTAATTTAAACCAAGTGCCAAGTGGATAAGTTATCTTGTTGTTATCCCATGTAAAACAATAGGCAAGAAAGCAGAGAATGTATTGCAGTGTGCCATTTGATATCAGAGGTTCCATTACCTCCTAAGAGATCCTTAACATCTGTTGGCTGAGCTGGCGAGTTCTTTGCATGAGAAGCCATGAGTAGATTGAGCTGCAGCCTGACATCTGGAATGCTCTTTCTAATTACAGTACTCGCAGAAGGAAGACAGATATGAGGAAGAGATCAAGGTCCTTTCCGACAAGCTGAAGGAGGCTGAGACTCGGGCTGAGTTTGCGGAGAGGTCAGTAACTAAATTGGAGAAAAGCATTGATGACTTAGAAGAGAAAGTGGCTCATGCCAAAGAAGAAAACCTTAGTATGCATCAGATGCTGGATCAGACTTTACTGGAGTTAAACAACATGTGAAAACCTCCTTAGCTGCGACCACATTCTTTCGTTTTGTTTTGTTTTGTTTTTAAACACCTGCTTACCCCTTAAATGCAATTTATTTACTTTTACCACTGTCACAGAAACATCCACAAGATACCAGCTAGGTCAGGGGGTGGGGAAAACACATACAAAAAGGCAAGCCCATGTCAGGGCGATCCTGGTTCAAATGTGCCATTTCCCGGGTTGATGCTGCCACACTTTGTAGAGAGTTTAGCAACACAGTGTGCTTAGTCAGCGTAGGAATCCTCACTAAAGCAGAAGAAGTTCCATTCAAAGTGCCAATGATAGAGTCAACAGGAAGGTTAATGTTGGAAACACAATCAGGTGTGGATTGGTGCTACTTTGAACAAAAGGTCCCCCTGTGGTCTTTTGTTCAACATTGTACAATGTAGAACTCTGTCCAACACTAATTTATTTTGTCTTGAGTTTTACTACAAGATGAGACTATGGATCCCGCATGCCTGAATTCACTAAAGCCAAGGGTCTGTAAGCCACGCTGCTCTTCCGAGACTTCCATTCCTTTCTGATTGGCACACGTGCAGCTCATGACAATCTGTAGGATAACAATCAGTGTGGATTTCCACTCTTTTCAGTCCTTCATGTTAAAGATTTAGACACCACATACAACTGGTAAAGGACGTTTTCTTGAGAGTTTTAACTATATGTAAACATTGTATAATGATATGGAATAAAATGCACATTGTAGGAC