Transcript asmbl_11127

Sequence
Transcript Sequence for observation asmbl_11127 of TGE0000088:
GGGAGGGAGCAAAGACGTTTCCCGCCGGCGGGAGCTGTGGCTGTGATTGAGAGAGGGGTTAGAGGCGGGTCCCAGCGCTGCCGCACCATGGCGGACCAGCTTTATCTGGAAAATATAGACGAGTTCGTCACGGACCAAAACAAGATCGTGACATACAAATGGCTGAGCTATACACTAGGGGTTCATGTTAACCAGGCCAAACAGATGCTGTATGATTATGTTGAAAGGAAACGAAAAGAAAATTCAGGAGCCCAACTGCATGTTACCTACTTGGTGTCTGGCAGTCTCATTCAGAATGGACATTCCTGCCACAAGGTTGCAGTAGTGAGAGAAGATAAATTGGAAGCAGTGAAGTCCAAGCTAGCTGTGACTGCCAGCATCCATGTGTACAGCATCCAGAAAGCCATGCTAAAGGACAGTGGGCCTCTGTTCAATACTGACTATGACATCCTTAAAAGCAACTTGCAGAACTGCAGCAAATTTAGTGCTATACAATGTGCAGCTGCCGTCCCTAGAGCTCCTGCTGAATCCTCTTCGTCTTCCAAAAAGTTTGAGCAGTCACATCTTCACATGTCAAGTGAGACACAAGCCAACAATGAGCTGACCACCAATGGTCATGGCCCACCTGCATCCAAGCAGGTTTCCCAGCAGCCCAAAGGAATTATGGGAATGTTTGCCTCCAAAGCTGCTGCTAAAACCCAAGAAACCAACAAGGAAACGAAAACAGAGGCTAAAGAAGTAACAAATGCATCTGCAGCAGGCAACAAGGCACCAGGGAAAGGGAATATGATGAGCAACTTTTTTGGAAAAGCTGCTATGAATAAATTTAAAGTCAATTTGGACTCAGAACAAGCAGTGAAAGAAGAAAAAATAGTGGAGCAGCCTACAGTGTCTGTCACGGAACCAAAGCTGGCAACTCCTGCAGGCCTGAAAAAATCCAGCAAAAAAGCAGAGCCTGTTAAGGTGCTGCAGAAGGAAAAAAAAAGGGGGAAGCGAGTAGCATTATCTGATGATGAGACAAAGGAAACTGAAAACATGAGGAAAAAGAGGAGAAGAATCAAACTTCCTGAATCTGATAGCAGTGAAGATGAAGTCTTTCCAGACTCTCCTGGGGCTTATGAAGCTGAGTCACCATCCCCACCTCCTCCTCCGTCTCCACCTCTTGAACCAGTGCCAAAGACTGAGCCTGAACCTCCTTCTGTCAAGAGCTCAAGTGGAGAAAACAAAAGAAAACGAAAACGCGTACTAAAATCTAAAACTTACCTGGATGGGGAAGGCTGCATAGTGACTGAAAAAGTCTACGAGAGTGAATCCTGCACAGATAGTGAAGAGGAGCTTAACATGAAGACATCCTCAGTACACAGACCCCCTGCCATGACTGTGAAAAAAGAACCCAGAGAGGAACGAAAGGGCCCCAAGAAAGGGACTGCTGCTCTGGGCAAAGCCAACAGACAGGTGTCCATTACTGGCTTCTTCCAGAGGAAATAAACTGCCATCTCTGGTAGATCAGAGACTTGGAGTGGTCAAGGGAGAAGACCAAGAAATGTACTCCTCACTTACTATGTAAGTTCATCTAGATCTCCACCTCACCTGTATCAAAAGACTGTTCTTTCATCCTGTGAGGTTTATACTATTTCTGGTTTTTAACCAAAAGGAAATCATCTGGAAGCAGGAGGCAAAAAGCTGTTACCTTCTAATGACATTTAAAAAGCACAGTCTTTGACCTGTCCAGGAGAAGGATTTACTCCAAAATTATACTGGAACAGTTTTCAGAATTCTCACTGAAGCCATTTAGTGGCTAACCCACTGTGCTCCACTCACCCTATGCCCTGGTCCGCATATGGCACAGGAATTATTCCTTCTTGT