Transcript asmbl_58861

Sequence
Transcript Sequence for observation asmbl_58861 of TGE0058678:
CTTTCCCTCTGTCTCTCCCGCTGTCCCTGTCCTTCTGGTTCTGTGCACCCACACCCCTCCCCTTCGGGATCACGCTGCCTGCTGCACCCCCCTCCCTCCCTGTACCCCCTGGCCAACTCCCAGCTGGAAGATGAGCTGGTGTCACTGCAAAAGAAACTCAAGGGCACCGAAGATGAACTGGACAAATACTCTGAGGCTCTCAAAGATGCCCAGGAGAAGCTGGAGCTGGCAGAGAAAAAGGCCACCGATGCTGAAGCCGACGTAGCTTCTCTGAACAGACGCATCCAGCTGGTTGAGGAAGAGTTGGATCGTGCCCAGGAGCGTCTGGCAACAGCTTTGCAGAAGCTGGAGGAAGCTGAGAAGGCAGCAGATGAGAGTGAGAGAGGCATGAAAGTCATTGAGAGTCGAGCCCAAAAAGATGAAGAAAAAATGGAAATTCAGGAGATCCAACTGAAAGAGGCCAAGCACATTGCTGAAGATGCC