Transcript asmbl_58860

Sequence
Transcript Sequence for observation asmbl_58860 of TGE0058677:
CGCGCCGCGGAGGGGCCCTAGAAGTGGAAGCCAGAGCCCTAGTGCAGTGGCCTCCCGGAGCGCCCAGCTCACCAGGTACCCCCGCAGCGCGCCGGGAGCGCCTTTCTCCCCGCCGCCGCGAGCATGCGCAGTGCCCCCAGCCAGTCCCGGGATCCACGGCGCGCGCCCCTCCCAGCCGCGCGCGCCCGCCTGCGGTTTGTCTGCGCAGCCCTGGAGGCTGCGACTTCCGGACTGCTCCTGGCCGCAGGGGGCGCCGCCATCGCACAGAGAGGCCTGGGCGGGGCGGACCGGCGCTGGGCAGCCAGGACAGCCGCGGCAGCCGGGTCCGCAGGGCAGCAGCCGGCCTCTCCCACTGCAGCCCTCCCGCCCGCCTACCGTCCGGCGCGATGGCGGGGAGTAGCTCGCTGGAGGCGGTGCGCAGGAAGATCCGGAGCCTGCAGGAGCAGGCGGACGCCGCTGAGGAGCGCGCGGGCACCCTGCAGCGCGAGCTGGACCACGAGAGGAAGCTGAGGGAGACCGCTGAAGCCGACGTAGCTTCTCTGAACAGACGCATCCAGCTGGTTGAGGAAGAGTTGGATCGTGCCCAGGAGCGTCTGGCAACAGCTTTGCAGAAGCTGGAGGAAGCTGAGAAGGCAGCAGATGAGAGTGAGAGAGGCATGAAAGTCATTGAGAGTCGAGCCCAAAAAGATGAAGAAAAAATGGAAATTCAGGAGATCCAACTGAAAGAGGCCAAGCACATTGCTGAAGATGCCGACCGCAAATATGAAGAGGTGGCCCGTAAGCTGGTCATCATTGAGAGCGACCTGGAACGTGCAGAGGAGCGGGCTGAGCTCTCAGAAGGCCAAGTCCGACAGCTGGAAGAACAATTAAGAATAATGGATCAGACCTTGAAAGCATTAATGGCTGCAGAGGATAAGTACTCGCAGAAGGAAGACAGATATGAGGAAGAGATCAAGGTCCTTTCCGACAAGCTGAAGGAGGCTGAGACTCGGGCTGAGTTTGCGGAGAGGTCAGTAACTAAATTGGAGAAAAGCATTGATGACTTAGAAGAGAAAGTGGCTCATGCCAAAGAAGAAAACCTTAGTATGCATCAGATGCTGGATCAGACTTTACTGGAGTTAAACAACATGTGAAAACCTCCTTAGCTGCGACCACATTCTTTCGTTTTGTTTTGTTTTGTTTTTAAACACCTGCTTACCCCTTAAATGCAATTTATTTACTTTTACCACTGTCACAGAAACATCCACAAGATACCAGCTAGGTCAGGGGGTGGGGAAAACACATACAAAAAGGCAAGCCCATGTCAGGGCGATCCTGGTTCAAATGTGCCATTTCCCGGGTTGATGCTGCCACACTTTGTAGAGAGTTTAGCAACACAGTGTGCTTAGTCAGCGTAGGAATCCTCACTAAAGCAGAAGAAGTTCCATTCAAAGTGCCAATGATAGAGTCAACAGGAAGGTTAATGTTGGAAACACAATCAGGTGTGGATTGGTGCTACTTTGAACAAAAGGTCCCCCTGTGGTCTTTTGTTCAACATTGTACAATGTAGAACTCTGTCCAACACTAATTTATTTTGTCTTGAGTTTTACTACAAGATGAGACTATGGATCCCGCATGCCTGAATTCACTAAAGCCAAGGGTCTGTAAGCCACGCTGCTCTTCCGAGACTTCCATTCCTTTCTGATTGGCACACGTGCAGCTCATGACAATCTGTAGGATAACAATCAGTGTGGATTTCCACTCTTTTCAGTCCTTCATGTTAAAGATTTAGACACCACATACAACTGGTAAAGGACGTTTTCTTGAGAGTTTTAACTATATGTAAACATTGTATAATGATATGGAATAAAATGCACATTGTAGGAC