Transcript asmbl_58859

Sequence
Transcript Sequence for observation asmbl_58859 of TGE0058676:
CGCGCCGCGGAGGGGCCCTAGAAGTGGAAGCCAGAGCCCTAGTGCAGTGGCCTCCCGGAGCGCCCAGCTCACCAGGTACCCCCGCAGCGCGCCGGGAGCGCCTTTCTCCCCGCCGCCGCGAGCATGCGCAGTGCCCCCAGCCAGTCCCGGGATCCACGGCGCGCGCCCCTCCCAGCCGCGCGCGCCCGCCTGCGGTTTGTCTGCGCAGCCCTGGAGGCTGCGACTTCCGGACTGCTCCTGGCCGCAGGGGGCGCCGCCATCGCACAGAGAGGCCTGGGCGGGGCGGACCGGCGCTGGGCAGCCAGGACAGCCGCGGCAGCCGGGTCCGCAGGGCAGCAGCCGGCCTCTCCCACTGCAGCCCTCCCGCCCGCCTACCGTCCGGCGCGATGGCGGGGAGTAGCTCGCTGGAGGCGGTGCGCAGGAAGATCCGGAGCCTGCAGGAGCAGGCGGACGCCGCTGAGGAGCGCGCGGGCACCCTGCAGCGCGAGCTGGACCACGAGAGGAAGCTGAGGGAGACCGCTGAAGCCGACGTAGCTTCTCTGAACAGACGCATCCAGCTGGTTGAGGAAGAGTTGGATCGTGCCCAGGAGCGTCTGGCAACAGCTTTGCAGAAGCTGGAGGAAGCTGAGAAGGCAGCAGATGAGAGTGAGAGAGGCATGAAAGTCATTGAGAGTCGAGCCCAAAAAGATGAAGAAAAAATGGAAATTCAGGAGATCCAACTGAAAGAGGCCAAGCACATTGCTGAAGATGCCGACCGCAAATATGAAGAGGTGGCCCGTAAGCTGGTCATCATTGAGAGCGACCTGGAACGTGCAGAGGAGCGGGCTGAGCTCTCAGAAGGCCAAGTCCGACAGCTGGAAGAACAATTAAGAATAATGGATCAGACCTTGAAAGCATTAATGGCTGCAGAGGATAAGGTACTGATGGCTCGTGTGGTTTTTAGGTTTAACTGCAACCCAGACATCTTTCAGCTTCCAATGCCTCCTGGTTCGTTTGGTATAACGACTGCACCTTCACTTCACCCTCTGCTATTTATATCTTGCCTTAAGTGCTTTCCCTTGGTCCTTTATGCTCCTTTGTTTTCCCTTCATAAATGCTCTTTGGGCAGCCAAAAAAGGAGCCAAATTATCGCACTTCAAAGTTGTTGGATTTGGTCACCCTGCCTTCTGCTGTTGCGAGGTTGGGGGGCAGTGTTCCTGGAAAACCTAAACATTTTAATACCTGATGATTTGGCTACTTTAAGGCAGCCCTTCGTCTCTAGGACTCAGTTTTCATTTTTTCCCATCCCTCTCCTTTTTCTCTCCTCCTTCCTTTGGCTTGTCTCCCACCCTTTCTGCCTCTGATCGAAAACATTAGCAAATGTGCCGAGCTTGAAGAAGAATTGAAAACTGTGACGAACAACTTGAAGTCACTGGAGGCTCAGGCTGAGAAGGTAGGCCAGGAGGATGGTGTGGGGGAAAGGCATCTTTTAAGAGCTGCTCAAAAGAGGCCCTGCCAGAAAGCAACACTTACAGTAGACATTTTAGTAAAATGGCAATATTGTGAGGTGATTTTTGGAGAGTTACTAGATAACAAATTCTTTTTTTTAACTAGAGAATTTATTTTATGTTAGGGATATGAGGCATCAATTTAATTTAAACCAAGTGCCAAGTGGATAAGTTATCTTGTTGTTATCCCATGTAAAACAATAGGCAAGAAAGCAGAGAATGTATTGCAGTGTGCCATTTGATATCAGAGGTTCCATTACCTCCTAAGAGATCCTTAACATCTGTTGGCTGAGCTGGCGAGTTCTTTGCATGAGAAGCCATGAGTAGATTGAGCTGCAGCCTGACATCTGGAATGCTCTTTCTAATTACAGTACTCGCAGAAGGAAGACAGATATGAGGAAGAGATCAAGGTCCTTTCCGACAAGCTGAAGGAGGCTGAGACTCGGGCTGAGTTTGCGGAGAGGTCAGTAACTAAATTGGAGAAAAGCATTGATGACTTAGAAGAGAAAGTGGCTCATGCCAAAGAAGAAAACCTTAGTATGCATCAGATGCTGGATCAGACTTTACTGGAGTTAAACAACATGTGAAAACCTCCTTAGCTGCGACCACATTCTTTCGTTTTGTTTTGTTTTGTTTTTAAACACCTGCTTACCCCTTAAATGCAATTTATTTACTTTTACCACTGTCACAGAAACATCCACAAGATACCAGCTAGGTCAGGGGGTGGGGAAAACACATACAAAAAGGCAAGCCCATGTCAGGGCGATCCTGGTTCAAATGTGCCATTTCCCGGGTTGATGCTGCCACACTTTGTAGAGAGTTTAGCAACACAGTGTGCTTAGTCAGCGTAGGAATCCTCACTAAAGCAGAAGAAGTTCCATTCAAAGTGCCAATGATAGAGTCAACAGGAAGGTTAATGTTGGAAACACAATCAGGTGTGGATTGGTGCTACTTTGAACAAAAGGTCCCCCTGTGGTCTTTTGTTCAACATTGTACAATGTAGAACTCTGTCCAACACTAATTTATTTTGTCTTGAGTTTTACTACAAGATGAGACTATGGATCCCGCATGCCTGAATTCACTAAAGCCAAGGGTCTGTAAGCCACGCTGCTCTTCCGAGACTTCCATTCCTTTCTGATTGGCACACGTGCAGCTCATGACAATCTGTAGGATAACAATCAGTGTGGATTTCCACTCTTTTCAGTCCTTCATGTTAAAGATTTAGACACCACATACAACTGGTAAAGGACGTTTTCTTGAGAGTTTTAACTATATGTAAACATTGTATAATGATATGGAATAAAATGCACATTGTAGGAC