Transcript asmbl_58858

Sequence
Transcript Sequence for observation asmbl_58858 of TGE0058675:
CGCGCCGCGGAGGGGCCCTAGAAGTGGAAGCCAGAGCCCTAGTGCAGTGGCCTCCCGGAGCGCCCAGCTCACCAGGTACCCCCGCAGCGCGCCGGGAGCGCCTTTCTCCCCGCCGCCGCGAGCATGCGCAGTGCCCCCAGCCAGTCCCGGGATCCACGGCGCGCGCCCCTCCCAGCCGCGCGCGCCCGCCTGCGGTTTGTCTGCGCAGCCCTGGAGGCTGCGACTTCCGGACTGCTCCTGGCCGCAGGGGGCGCCGCCATCGCACAGAGAGGCCTGGGCGGGGCGGACCGGCGCTGGGCAGCCAGGACAGCCGCGGCAGCCGGGTCCGCAGGGCAGCAGCCGGCCTCTCCCACTGCAGCCCTCCCGCCCGCCTACCGTCCGGCGCGATGGCGGGGAGTAGCTCGCTGGAGGCGGTGCGCAGGAAGATCCGGAGCCTGCAGGAGCAGGCGGACGCCGCTGAGGAGCGCGCGGGCACCCTGCAGCGCGAGCTGGACCACGAGAGGAAGCTGAGGGAGACCGCTGAAGCCGACGTAGCTTCTCTGAACAGACGCATCCAGCTGGTTGAGGAAGAGTTGGATCGTGCCCAGGAGCGTCTGGCAACAGCTTTGCAGAAGCTGGAGGAAGCTGAGAAGGCAGCAGATGAGAGTGAGAGAGGCATGAAAGTCATTGAGAGTCGAGCCCAAAAAGATGAAGAAAAAATGGAAATTCAGGAGATCCAACTGAAAGAGGCCAAGCACATTGCTGAAGATGCCGACCGCAAATATGAAGAGGTGGCCCGTAAGCTGGTCATCATTGAGAGCGACCTGGAACGTGCAGAGGAGCGGGCTGAGCTCTCAGAAGGCCAAGTCCGACAGCTGGAAGAACAATTAAGAATAATGGATCAGACCTTGAAAGCATTAATGGCTGCAGAGGATAAGCAAATGTGCCGAGCTTGAAGAAGAATTGAAAACTGTGACGAACAACTTGAAGTCACTGGAGGCTCAGGCTGAGAAGTACTCGCAGAAGGAAGACAGATATGAGGAAGAGATCAAGGTCCTTTCCGACAAGCTGAAGGAGGCTGAGACTCGGGCTGAGTTTGCGGAGAGGTCAGTAACTAAATTGGAGAAAAGCATTGATGACTTAGAAGAGAAAGTGGCTCATGCCAAAGAAGAAAACCTTAGTATGCATCAGATGCTGGATCAGACTTTACTGGAGTTAAACAACATGTGAAAACCTCCTTAGCTGCGACCACATTCTTTCGTTTTGTTTTGTTTTGTTTTTAAACACCTGCTTACCCCTTAAATGCAATTTATTTACTTTTACCACTGTCACAGAAACATCCACAAGATACCAGCTAGGTCAGGGGGTGGGGAAAACACATACAAAAAGGCAAGCCCATGTCAGGGCGATCCTGGTTCAAATGTGCCATTTCCCGGGTTGATGCTGCCACACTTTGTAGAGAGTTTAGCAACACAGTGTGCTTAGTCAGCGTAGGAATCCTCACTAAAGCAGAAGAAGTTCCATTCAAAGTGCCAATGATAGAGTCAACAGGAAGGTTAATGTTGGAAACACAATCAGGTGTGGATTGGTGCTACTTTGAACAAAAGGTCCCCCTGTGGTCTTTTGTTCAACATTGTACAATGTAGAACTCTGTCCAACACTAATTTATTTTGTCTTGAGTTTTACTACAAGATGAGACTATGGATCCCGCATGCCTGAATTCACTAAAGCCAAGGGTCTGTAAGCCACGCTGCTCTTCCGAGACTTCCATTCCTTTCTGATTGGCACACGTGCAGCTCATGACAATCTGTAGGATAACAATCAGTGTGGATTTCCACTCTTTTCAGTCCTTCATGTTAAAGATTTAGACACCACATACAACTGGTAAAGGACGTTTTCTTGAGAGTTTTAACTATATGTAAACATTGTATAATGATATGGAATAAAATGCACATTGTAGGAC