Transcript asmbl_58856

Sequence
Transcript Sequence for observation asmbl_58856 of TGE0056236:
AGGTGATGGTGACCAATGTCACCTCGCTCCTCAAGACTGTAAAGGCAGTGGAGGATGAGGCCACCCGGGGCACCAGGGCGCTTGAGGCCACAATTGAATGCATAAAGCAGGAGCTTACGGTGTTCCAGTCAAAAGACGTACCTGAAAAGACATCATCACCTGAAGAATCCATAAGGATGACGAAAGGCATCACCATGGCAACAGCCAAAGCCGTGGCAGCTGGGAACTCATGTAGACAGGAGGACGTGATTGCTACTGCCAACCTGAGCCGGAAAGCCGTGTCAGATATGTTGACGGCTTGCAAGCAAGCATCCTTCCACCCCGATGTCAGTGACGAGGTGAGAACCAGAGCCTTGCGTTTCGGGACGGAGTGCACCCTTGGCTACTTGGACCTCCTGGAGCACGTCTTGGTGATTCTTCAGAAACCAACCCCAGAATTCAAGCAGCAGCTGGCCGCTTTCTCCAAGCGAGTCGCCGGCGCTGTGACAGAGCTCATCCAGGCGGCGGAAGCCATGAAAGGAACAGAGTGGGTGGATCCAGAAGACCCAACTGTCATTGCAGAAACAGAGTTACTGGGGGCTGCAGCATCCATCGAAGCTGCTGCTAAGAAGTTAGAGCAACTGAAGCCAAGAGCAAAACCAAAACAAGCGGATGAGACCCTGGACTTTGAGGAACAGATCTTGGAAGCTGCTAAATCCATTGCTGCTGCCACAAGCGCCCTGGTCAAATCGGCCTCAGCAGCCCAGAGGGAGCTGGTGGCCCAAGGAAAGGTGGGCTCCATCCCTGCCAATGCTGCAGACGACGGACAGTGGTCACAGGGGCTGATTTCTGCTGCCCGGATGGTGGCGGCTGCGACCAGCAGTCTCTGTGAGGCGGCCAATGCCTCCGTTCAGGGACACGCCAGCGAGGAGAAGCTCATCTCATCTGCCAAGCAGGTCGCCGCTTCCACGGCTCAGCTGCTGGTGGCCTGCAAGGTGAAGGCCGACCAGGATTCAGAGGCCATGAGGCGGCTACAGGCGGCAGGAAATGCTGTGAAAAGAGCCTCAGACAATCTTGTCCGTGCAGCCCAGAAGGCAGCTTTTGGCAAAGCTGATGACGACGATGTTGTAGTGAAAACCAAGTTTGTGGGGGGCATTGCTCAGATCATCGCCGCCCAGGAAGAAATGCTAAAGAAAGAGCGAGAACTGGAAGAAGCAAGGAAAAAACTGGCCCAAATCCGCCAGCAGCAGTATAAGTTTTTACCCACCGAGCTGAGGGAAGATGAGGGCTAAAGGTGCGAGCCCAGATGGCGAGCCCCAGGGGATGGCCCTGGCTGAACTGGACAGACAGTGTTCCTGAGAGGCTGGGCACTTAGCTGGAAACCGCCCACCTCCCTCCCGGGTGAGCCTGGAGCCCTGCGTGCTTGTTCTCACATCTCTGTCCCGTCGGCACTGGCTGCATGATCGTGATGTCACACGGTACAATGTCCTACCCACAACTCCTCTGCCGCCTCCCCTCATGCCTCACCGTGTCTCAGGAGAGAGGGGTGCACGTTTCATGGACTGTTACCAACAAAGAAAAGTCAGTATTATGTTGTTCTCAGACACTTTGGCTTTTGTTGGTCCTTCTCTTAGGCCTGCTCCTGGACCTCTTTATGATATTGTGATAGGGAAAAAAATCATTGACGTCATAGAATATTCTTCTTCCTCTCAGGAGAAGACGGAAGCTGGAGTTGGACATGGTTCATAAAAGCCAGAAACACAAACCCGTGTGGACTCCGGGAGGGTGACTCAGGTCCTCCTTCCATGTCTTGAGCACTGGCTCACCCAGGGGGTGAAAAATTCCCGCCCCTGTTTGCACGCTTTCTTGCCTCCGTGTGTAAGCTCCTTGTACAACCCAGACCCATCTTGTATTTTGTGGCCCAGAAAACTGAACGATTATTTTGTTCCTCCGTAGTCCAAAGGGCAGAGTTGCGGAAGGCCGTCGGGGCTTGGTGAGCAGGGGCTGTAATACAGTCTGTGGGCTCCTTACCCTGCAGAGGCTGTTTCAGCTCACACAGAGTCATCCACACAAACCCACGGCTCCCAGTTGACAGTCAGTGGAATGCTCGTCTCCTTAGCGTCCAGGGTGGGGATTCTGCTGGAATAAAGAGCTTCCTCAGTGACTCATCTTTAGGTCCCACGCTGGTTTCTGTGCCTTCAGAATGGTCACAAGCCCGGATTGGAAAGGATCTGCTTACAAACCTGTCCCCTGTCCTCCAACCCAAAACGCCTTTTTTTCTGTCTTAATATCCAGAAAATCTAAATGCATCCTAAAATCAATGTGAACCTTTAACAAGATAGTTTTACTTATTATCACATAAGACATAAGATGTTTTCATTTTCTGGATGTCACACTTCCAGAATTTCATATTTTTCCCCTCTTTTCTTTCCCCTTTTCAGAGCCCTCCCATAGGAAGGGAAGGGCTTGAATTTACCCTTAATCTGCACCTTTAGCCAAGGCAGTGCATGGAAGATGAATGGCTCGTGGGACAGAATCTAATGCCAGGGAGCAGGAGTGTTTGAAAGAATTCATAGTGGGGAAGGTAAAAGTTAATGGAAGTACATGATTTTCAAAACTGGTAACAGTTAAAGGCACTCACCCTCCGCCTCTCTCTCTCTCTCTCTCTCT