Transcript asmbl_58853

Sequence
Transcript Sequence for observation asmbl_58853 of TGE0058673:
CGCTCGCGCTCGCCCTCGGCTCTTGTTCCGCGCCCGGAGCCAGCGGCGGCGGCAGCGGCTGAGGCGGCTGCGGGAGCGGAGTGGTCGCCCAGCGCGCGGGGGGACGCGGGCTGCACTCCCGGGCAGGCGCTCTGCAATGAGACAGTAAATGCATCCCCCGGTGCTGCAGGAGGCTTCTCACATGCTTTGGGATATCTTCAGGGAAATACGCTCTTAATAGAAACTGAGAATTTAAGAAAGTCTGCCTGGCGGAGGACACCTGCACTTGTTACCCTGAGTTGATTCCTGAAACTTCGGACCCCTGGGTATTAACAGAGGACTCAGTGGGAGCTCCTGGTCAGAGGACTTGGATGTTGTCATTACATTCTAAGTGAGACTGTCCACATCATCTAGGAAAATGGTGGCCCTGTCCTTAAAGATTTGTGTGCGCCACTGCAACGTGGTGAAGACCATGCAGTTTGAACCATCTACAGCTGTGTACGATGCGTGTCGAGTCATTCGGGAACGGGTGCCTGAGGCACAAACTGGGCAAGCTTCTGACTATGGACTCTTTCTTTCGGATGAAGACCCGAGGAAAGGGATTTGGCTGGAAGCGGGCAGAACACTGGATTACTACATGTTGCGGAATGGGGATATTTTGGAATATAAAAAGAAACAGAGACCTCAGAAAATCCGGATGCTGGATGGATCTGTGAAGACAGTGATGGTGGATGATTCCAAGACTGTGGGGGAGCTCCTGGTCACTATTTGTAGCAGAATAGGAATAACAAATTATGAAGAATACTCCTTAATCCAAGAAACTATTGAAGAAAAGAAAGAGGAAGGAACGGGCACACTCAAAAAAGACAGGACACTGTTACGAGATGAGAGGAAAATGGAGAAGTTGAAGGCCAAGCTGCACACAGATGATGACCTAAATTGGCTGGATCACAGCCGAACATTCAGAGAACAAGGAGTAGATGAAAACGAAACGTTGCTGCTTAGACGGAAGTTCTTTTACTCTGATCAGAATGTAGATTCGAGAGACCCCGTGCAGCTGAACTTGCTTTATGTTCAGGCACGGGATGACATCCTGAATGGCTCTCACCCTGTCTCCTTCGAGAAAGCTTGTGAGTTTGGTGGATTTCAAGCCCAGATACAATTTGGACCTCATGTGGAACATAAACACAAACCTGGATTTTTAGATCTGAAGGAATTCCTGCCCAAAGAATATATCAAGCAGAGAGGAGCTGAAAAGAGGATCTTTCAGGAGCATAAGAACTGCGGAGAGATGAGTGAGATAGAAGCCAAGGTCAAGTACGTCAAACTCGCACGGTCCCTCCGCACATATGGCGTGTCCTTCTTCCTGGTGAAGGAGAAGATGAAAGGCAAGAACAAGCTGGTGCCTCGCCTGCTGGGGATCACCAAAGACTCGGTGATGCGCGTGGATGAGAAGACCAAGGAAGTGCTGCAGGAGTGGCCCCTCACCACCGTCAAGCGCTGGGCAGCCTCACCCAAGAGCTTCACACTGGATTTTGGGGAGTATCAGGAAAGCTACTATTCAGTACAAACCACCGAGGGAGAGCAGATATCCCAGCTGATTGCAGGCTACATTGACATCATCCTGAAAAAGAAACAAAGTAAAGATCGATTTGGACTAGAAGGTGATGAGGAGTCAACCATGTTAGAAGAGTCCGTTTCCCCAAAAAAGTCCACCATCTTGCAGCAGCAGTTCAACCGGACCGGGAAGGCAGAGCACGGCTCAGTGGCGCTGCCGGCCGTGATGCGCTCGGGCTCCAGCGGGCCTGAGACCTTCAACGTTGGCAGCATGCCCTCGCCACAGCAGCAGGTCATGGTTGGGCAGATGCACCGAGGCCACATGCCGCCACTGACCTCAGCCCAGCAGGCCCTGATGGGGACCATCAACACAAGCATGCACGCCGTCCAGCAGGCCCAGGATGATCTCAGTGAGCTCGACTCGCTGCCACCTCTCGGCCAGGATATGGCATCTAGGGTATGGGTTCAGAACAAAGTCGACGAATCCAAACACGAAATCCATTCTCAAGTTGATGCTATCACGGCCGGAACGGCTTCAGTTGTTAACCTCACAGCTGGTGACCCTGCAGACACTGACTACACAGCTGTGGGATGTGCGATCACCACTATTTCTTCCAACCTGACGGAGATGTCCAAGGGTGTGAAGCTATTGGCCGCCCTCATGGATGATGAGGTGGGCAGCGGGGAGGACTTGCTCAGAGCTGCCAGGACCCTCGCTGGGGCGGTGTCAGACTTGCTGAAAGCTGTGCAGCCTACTTCTGGAGAGCCTCGACAGACAGTTTTGACTGCTGCTGGCAGCATCGGACAAGCCAGTGGGGATCTTCTGAGACAGATTGGAGAGAATGAGACTGATGAGCGATTCCAGGATGTTTTAATGAGTTTGGCCAAAGCTGTTGCCAATGCAGCTGCCATGTTGGTACTAAAGGCAAAGAATGTTGCCCAAGTGGCCGAAGACACTGTCCTACAGAACAGGGTAATTGCTGCTGCCACCCAGTGTGCCCTCTCCACCTCCCAGCTTGTGGCATGTGCCAAGGTTGTGAGCCCCACTATTAGCTCCCCTGTGTGCCAGGAGCAGCTGATTGAAGCAGGGAAGCTGGTGGACCGCTCGGTGGAGAACTGTGTCCGTGCCTGCCAGGCGGCCACTACCGATAGTGAGCTCCTGAAGCAGGTCAGCGCAGCGGCCAGCGTGGTCAGCCAGGCCCTCCATGATCTCCTGCAGCATGTGCGGCAGTTTGCCAGCCGAGGCGAGCCCATCGGCCGCTACGACCAGGCTACTGACACCATCATGTGTGTCACCGAGAGCATCTTCAGCTCCATGGGTGACGCTGGTGAAATGGTGCGCCAGGCGCGGGTTCTGGCCCAAGCCACATCAGACCTCGTCAATGCCATGAGGTCAGATGCAGAAGCCGAAATCGACATGGAGAATTCAAAGAAGCTCCTGGCAGCAGCAAAACTCTTAGCTGACTCCACTGCTCGCATGGTGGAAGCTGCAAAGGGGGCTGCAGCCAACCCAGAGAATGAGGACCAGCAGCAAAGGCTGAGAGAAGCTGCAGAAGGCCTCCGGGTAGCAACCAACGCAGCTGCCCAGAATGCTATTAAGAAAAAAATTGTCAACCGACTGGAGGTTGCAGCCAAGCAGGCCGCAGCGGCAGCCACACAGACCATCGCCGCCTCCCAGAATGCAGCTGTTTCCAACAAGAACCCTGCGGCCCAGCAGCAGCTGGTCCAGAGTTGCAAGGCAGTGGCTGATCACATCCCTCAGCTGGTCCAGGGAGTGAGGGGGAGCCAAGCTCAAGCTGAAGACCTGAGTGCCCAGCTGGCTCTCATCATCTCCAGCCAGAACTTCCTCCAGCCTGGAAGCAAGATGGTGTCCTCTGCCAAAGCCGCAGTGCCCACCGTGAGTGACCAGGCCGCAGCCATGCAGCTGAGCCAGTGTGCCAAGAACCTGGCCACCAGCTTGGCGGAGCTGCGTACCGCCTCGCAGAAGGCCCATGAAGCTTGTGGTCCGATGGAAATCGATTCAGCTCTGAATACGGTGCAGACGCTTAAGAATGAACTGCAGGATGCCAAGATGGCAGCCGTGGAGAGCCAGCTGAAGCCACTTCCAGGGGAAACGCTGGAAAAATGTGCTCAGGACCTGGGAAGCACATCCAAGGCGGTGGGCTCCTCCATGGCACAGCTGCTGACCTGTGCTGCTCAAGGCAACGAACACTACACAGGGGTGGCTGCTAGAGAGACGGCCCAAGCTCTGAAAACACTGGCCCAGGCCGCCCGTGGAGTGGCTGCATCGACAACCGACCCCGCGGCCGCCCATGCCATGTTAGATTCTGCTCGAGACGTGATGGAGGGCTCCGCCATGCTCATTCAAGAGGCCAAGCAGGCCCTGATTGCACCTGGAGATGCAGAGCGTCAACAAAGACTGGCTCAGGTGGCTAAAGCCGTCTCACACTCCTTGAATAACTGCGTAAATTGCCTCCCTGGGCAGAAGGATGTGGACGTGGCCTTGAAGAGCATCGGGGAGTCCAGCAAGAAGCTGCTTGTGGATTCGCTACCTCCAAGCACGAAGCCTTTCCAGGAAGCCCAGAGTGAACTGAACCAGGCAGCAGCTGATCTGAACCAGTCTGCTGGGGAAGTGGTCCATGCCACCCGGGGCCAGAGTGGAGAGTTGGCTGCAGCCTCTGGAAAGTTCAGTGATGATTTTGATGAATTCCTCGATGCTGGCATTGAGATGGCTGGCCAAGCTCAGACAAAAGAAGACCAGATCCAAGTGATAGGGAACCTCAAGAATATCTCGATGGCATCCAGCAAGCTGCTGTTAGCTGCCAAGTCTCTCTCTGTAGATCCAGGAGCTCCCAATGCGAAAAATCTCCTGGCTGCAGCTGCAAGAGCTGTGACAGAGAGCATCAATCAACTCATCACTCTGTGTACCCAACAAGCTCCGGGCCAGAAAGAGTGCGATAATGCCCTGCGGGAGCTCGAGACTGTGAAGGGGATGTTGGACAATCCTAATGAACCTGTTAGTGACCTCTCTTACTTTGACTGCATTGAGAGTGTGATGGAAAACTCCAAGGTTCTGGGTGAATCGATGGCAGGGATTTCACAGAATGCCAAGACCGGAGACCTCCCTGCCTTTGGGGAATGTGTGGGGATTGCATCCAAGGCTCTCTGTGGGCTGACAGAGGCTGCAGCCCAGGCTGCATACTTGGTTGGCATCTCTGATCCAAACAGCCAGGCAGGCCACCAGGGCCTGGTGGACCCCATCCAGTTTGCCAGGGCTAACCAGGCCATCCAGATGGCATGCCAGAACTTGGTGGACCCTGGCAGCAGCCCATCACAGGTCCTGTCAGCCGCCACAATTGTTGCCAAGCACACGTCAGCCTTGTGCAATGCCTGCCGCATCGCCTCATCCAAGACGGCCAACCCAGTAGCCAAGAGGCACTTCGTCCAGTCAGCCAAGGAAGTCGCCAACAGCACTGCCAACCTGGTGAAGACCATCAAGGCCCTGGATGGGGATTTCTCTGAAGACAACCGCAATAAGTGTCGCATCGCCACCGCACCCTTGATTGAAGCTGTGGAGAACCTGACAGCGTTCGCCTCAAACCCTGAGTTTGTCAGCATTCCTGCCCAGATCAGCTCCGAGGGTTCCCAGGCACAGGAACCAATCCTGGTCTCAGCCAAGACCATGCTGGAGAGTTCATCGTACCTCATTCGCACTGCACGCTCTCTGGCCATCAACCCCAAAGACCCACCCACCTGGTCTGTACTGGCTGGACATTCCCATACAGTGTCCGACTCCATCAAGAGTCTCATCACTTCTATCAGGGACAAGGCCCCTGGACAGAGGGAGTGTGATTACTCCATCGATGGCATCAACCGGTGCATCCGGGACATCGAGCAGGCCTCGCTGGCCGCCGTCAGCCAGAGCCTGGCCACGAGGGACGACATCTCTGTGGAGGCCCTGCAGGAGCAGCTGACTTCGGTGGTCCAGGAAATCGGACACCTTATCGATCCCATCGCCACAGCGGCTCGGGGAGAAGCAGCTCAGCTGGGACATAAGGTGACACAACTGGCAAGCTATTTTGAGCCCTTGATCTTAGCCGCAGTTGGTGTGGCCTCCAAGATTCTTGATCATCAGCAGCAGATGACGGTGCTGGACCAGACCAAGACTCTCGCAGAGTCTGCCTTGCAGATGTTGTATGCAGCCAAAGAAGGTGGCGGAAACCCCAAGGCACAACACACCCATGACGCCATCACAGAGGCCGCCCAGTTGATGAAGGAAGCCGTGGATGACATCATGGTGACGCTGAACGAAGCTGCCAGTGAAGTGGGGCTGGTTGGGGGCATGGTGGACGCCATTGCAGAAGCCATGAGCAAGCTGGATGAAGGCACTCCTCCAGAACCAAAGGGAACATTTGTCGACTATCAGACGACTGTGGTTAAATACTCCAAAGCCATTGCGGTGACAGCTCAGGAAATGATGACTAAGTCGGTTACTAACCCGGAGGAGTTGGGAGGACTGGCTTCACAAATGACCAGTGACTATGGGCACCTGGCTTTCCAGGGCCAGATGGCAGCAGCCACGGCGGAACCAGAGGAGATCGGATTCCAGATTCGCACTCGTGTGCAGGACCTGGGCCACGGCTGTATCTTCCTGGTGCAGAAGGCAGGGGCCCTCCAGGTCTGCCCCACAGACAGCTACACCAAGAGGGAGCTGATCGAATGCGCCCGTGCCGTCACGGAAAAGGTCTCCTTGGTGCTCTCGGCTCTCCAGGCCGGGAACAAAGGAACCCAGGCATGCATTACAGCCGCCACCGCTGTGTCTGGGATCATTGCCGACCTGGACACCACCATTATGTTTGCAACAGCGGGGACGCTGAATGCAGAGAACAGTGAGACCTTCGCAGACCACAGGGAGAACATTCTCAAGACGGCCAAGGCCTTGGTAGAAGACACGAAACTACTTGTGTCAGGAGCTGCGTCCACTCCTGACAAGCTGGCCCAGGCGGCCCAGTCCTCAGCAGCCACCATCACCCAGCTCGCAGAAGTGGTCAAGCTGGGGGCAGCCAGCCTGGGCTCCGACGACCCCGAGACCCAGGTGGTTTTGATCAATGCCATCAAAGATGTGGCCAAGGCCCTTTCTGATCTCATCAGTGCTACCAAGGGAGCTGCCAGCAAGCCAGTGGACGACCCTTCCATGTACCAGCTCAAGGGGGCTGCCAAGGT