Transcript asmbl_58852

Sequence
Transcript Sequence for observation asmbl_58852 of TGE0058671:
CGCTCGCGCTCGCCCTCGGCTCTTGTTCCGCGCCCGGAGCCAGCGGCGGCGGCAGCGGCTGAGGCGGCTGCGGGAGCGGAGTGGTCGCCCAGCGCGCGGGGGGACGCGGGCTGCACTCCCGGGCAGGCGCTCTGCAATGAGACAGTAAATGCATCCCCCGGTGCTGCAGGAGGCTTCTCACATGCTTTGGGATATCTTCAGGGAAATACGCTCTTAATAGAAACTGAGAATTTAAGACATTCTAAGTGAGACTGTCCACATCATCTAGGAAAATGGTGGCCCTGTCCTTAAAGATTTGTGTGCGCCACTGCAACGTGGTGAAGACCATGCAGTTTGAACCATCTACAGCTGTGTACGATGCGTGTCGAGTCATTCGGGAACGGGTGCCTGAGGCACAAACTGGGCAAGCTTCTGACTATGGACTCTTTCTTTCGGATGAAGACCCGAGGAAAGGGATTTGGCTGGAAGCGGGCAGAACACTGGATTACTACATGTTGCGGAATGGGGATATTTTGGAATATAAAAAGAAACAGAGACCTCAGAAAATCCGGATGCTGGATGGATCTGTGAAGACAGTGATGGTGGATGATTCCAAGACTGTGGGGGAGCTCCTGGTCACTATTTGTAGCAGAATAGGAATAACAAATTATGAAGAATACTCCTTAATCCAAGAAACTATTGAAGAAAAGAAAGAGGAAGGAACGGGCACACTCAAAAAAGACAGGACACTGTTACGAGATGAGAGGAAAATGGAGAAGTTGAAGGCCAAGCTGCACACAGATGATGACCTAAATTGGCTGGATCACAGCCGAACATTCAGAGAACAAGGAGTAGATGAAAACGAAACGTTGCTGCTTAGACGGAAGTTCTTTTACTCTGATCAGAATGTAGATTCGAGAGACCCCGTGCAGCTGAACTTGCTTTATGTTCAGGCACGGGATGACATCCTGAATGGCTCTCACCCTGTCTCCTTCGAGAAAGCTTGTGAGTTTGGTGGATTTCAAGCCCAGATACAATTTGGACCTCATGTGGAACATAAACACAAACCTGGATTTTTAGATCTGAAGGAATTCCTGCCCAAAGAATATATCAAGCAGAGAGGAGCTGAAAAGAGGATCTTTCAGGAGCATAAGAACTGCGGAGAGATGAGTGAGATAGAAGCCAAGGTCAAGTACGTCAAACTCGCACGGTCCCTCCGCACATATGGCGTGTCCTTCTTCCTGGTGAAGGAGAAGATGAAAGGCAAGAACAAGCTGGTGCCTCGCCTGCTGGGGATCACCAAAGACTCGGTGATGCGCGTGGATGAGAAGACCAAGGAAGTGCTGCAGGAGTGGCCCCTCACCACCGTCAAGCGCTGGGCAGCCTCACCCAAGAGCTTCACACTGGATTTTGGGGAGTATCAGGAAAGCTACTATTCAGTACAAACCACCGAGGGAGAGCAGATATCCCAGCTGATTGCAGGCTACATTGACATCATCCTGAAAAAGAAACAAAGTAAAGATCGATTTGGACTAGAAGGTGATGAGGAGTCAACCATGTTAGAAGAGTCCGTTTCCCCAAAAAAGTCCACCATCTTGCAGCAGCAGTTCAACCGGACCGGGAAGGCAGAGCACGGCTCAGTGGCGCTGCCGGCCGTGATGCGCTCGGGCTCCAGCGGGCCTGAGACCTTCAACGTTGGCAGCATGCCCTCGCCACAGCAGCAGGTCATGGTTGGGCAGATGCACCGAGGCCACATGCCGCCACTGACCTCAGCCCAGCAGGCCCTGATGGGGACCATCAACACAAGCATGCACGCCGTCCAGCAGGCCCAGGATGATCTCAGTGAGCTCGACTCGCTGCCACCTCTCGGCCAGGATATGGCATCTAGGGTATGGGTTCAGAACAAAGTCGACGAATCCAAACACGAAATCCATTCTCAAGTTGATGCTATCACGGCCGGAACGGCTTCAGTTGTTAACCTCACAGCTGGTGACCCTGCAGACACTGACTACACAGCTGTGGGATGTGCGATCACCACTATTTCTTCCAACCTGACGGAGATGTCCAAGGGTGTGAAGCTATTGGCCGCCCTCATGGATGATGAGGTGGGCAGCGGGGAGGACTTGCTCAGAGCTGCCAGGACCCTCGCTGGGGCGGTGTCAGACTTGCTGAAAGCTGTGCAGCCTACTTCTGGAGAGCCTCGACAGACAGTTTTGACTGCTGCTGGCAGCATCGGACAAGCCAGTGGGGATCTTCTGAGACAGATTGGAGAGAATGAGACTGATGAGCGATTCCAGGATGTTTTAATGAGTTTGGCCAAAGCTGTTGCCAATGCAGCTGCCATGTTGGTACTAAAGGCAAAGAATGTTGCCCAAGTGGCCGAAGACACTGTCCTACAGAACAGGGTAATTGCTGCTGCCACCCAGTGTGCCCTCTCCACCTCCCAGCTTGTGGCATGTGCCAAGGTTGTGAGCCCCACTATTAGCTCCCCTGTGTGCCAGGAGCAGCTGATTGAAGCAGGGAAGCTGGTGGACCGCTCGGTGGAGAACTGTGTCCGTGCCTGCCAGGCGGCCACTACCGATAGTGAGCTCCTGAAGCAGGTCAGCGCAGCGGCCAGCGTGGTCAGCCAGGCCCTCCATGATCTCCTGCAGCATGTGCGGCAGTTTGCCAGCCGAGGCGAGCCCATCGGCCGCTACGACCAGGCTACTGACACCATCATGTGTGTCACCGAGAGCATCTTCAGCTCCATGGGTGACGCTGGTGAAATGGTGCGCCAGGCGCGGGTTCTGGCCCAAGCCACATCAGACCTCGTCAATGCCATGAGGTCAGATGCAGAAGCCGAAATCGACATGGAGAATTCAAAGAAGCTCCTGGCAGCAGCAAAACTCTTAGCTGACTCCACTGCTCGCATGGTGGAAGCTGCAAAGGGGGCTGCAGCCAACCCAGAGAATGAGGACCAGCAGCAAAGGCTGAGAGAAGCTGCAGAAGGCCTCCGGGTAGCAACCAACGCAGCTGCCCAGAATGCTATTAAGAAAAAAATTGTCAACCGACTGGAGGTTGCAGCCAAGCAGGCCGCAGCGGCAGCCACACAGACCATCGCCGCCTCCCAGAATGCAGCTGTTTCCAACAAGAACCCTGCGGCCCAGCAGCAGCTGGTCCAGAGTTGCAAGGCAGTGGCTGATCACATCCCTCAGCTGGTCCAGGGAGTGAGGGGGAGCCAAGCTCAAGCTGAAGACCTGAGTGCCCAGCTGGCTCTCATCATCTCCAGCCAGAACTTCCTCCAGCCTGGAAGCAAGATGGTGTCCTCTGCCAAAGCCGCAGTGCCCACCGTGAGTGACCAGGCCGCAGCCATGCAGCTGAGCCAGTGTGCCAAGAACCTGGCCACCAGCTTGGCGGAGCTGCGTACCGCCTCGCAGAAGGCCCATGAAGCTTGTGGTCCGATGGAAATCGATTCAGCTCTGAATACGGTGCAGACGCTTAAGAATGAACTGCAGGATGCCAAGATGGCAGCCGTGGAGAGCCAGCTGAAGCCACTTCCAGGGGAAACGCTGGAAAAATGTGCTCAGGACCTGGGAAGCACATCCAAGGCGGTGGGCTCCTCCATGGCACAGCTGCTGACCTGTGCTGCTCAAGGCAACGAACACTACACAGGGGTGGCTGCTAGAGAGACGGCCCAAGCTCTGAAAACACTGGCCCAGGCCGCCCGTGGAGTGGCTGCATCGACAACCGACCCCGCGGCCGCCCATGCCATGTTAGATTCTGCTCGAGACGTGATGGAGGGCTCCGCCATGCTCATTCAAGAGGCCAAGCAGGCCCTGATTGCACCTGGAGATGCAGAGCGTCAACAAAGACTGGCTCAGGTGGCTAAAGCCGTCTCACACTCCTTGAATAACTGCGTAAATTGCCTCCCTGGGCAGAAGGATGTGGACGTGGCCTTGAAGAGCATCGGGGAGTCCAGCAAGAAGCTGCTTGTGGATTCGCTACCTCCAAGCACGAAGCCTTTCCAGGAAGCCCAGAGTGAACTGAACCAGGCAGCAGCTGATCTGAACCAGTCTGCTGGGGAAGTGGTCCATGCCACCCGGGGCCAGAGTGGAGAGTTGGCTGCAGCCTCTGGAAAGTTCAGTGATGATTTTGATGAATTCCTCGATGCTGGCATTGAGATGGCTGGCCAAGCTCAGACAAAAGAAGACCAGATCCAAGTGATAGGGAACCTCAAGAATATCTCGATGGCATCCAGCAAGCTGCTGTTAGCTGCCAAGTCTCTCTCTGTAGATCCAGGAGCTCCCAATGCGAAAAATCTCCTGGCTGCAGCTGCAAGAGCTGTGACAGAGAGCATCAATCAACTCATCACTCTGTGTACCCAACAAGCTCCGGGCCAGAAAGAGTGCGATAATGCCCTGCGGGAGCTCGAGACTGTGAAGGGGATGTTGGACAATCCTAATGAACCTGTTAGTGACCTCTCTTACTTTGACTGCATTGAGAGTGTGATGGAAAACTCCAAGGTTCTGGGTGAATCGATGGCAGGGATTTCACAGAATGCCAAGACCGGAGACCTCCCTGCCTTTGGGGAATGTGTGGGGATTGCATCCAAGGCTCTCTGTGGGCTGACAGAGGCTGCAGCCCAGGCTGCATACTTGGTTGGCATCTCTGATCCAAACAGCCAGGCAGGCCACCAGGGCCTGGTGGACCCCATCCAGTTTGCCAGGGCTAACCAGGCCATCCAGATGGCATGCCAGAACTTGGTGGACCCTGGCAGCAGCCCATCACAGGTCCTGTCAGCCGCCACAATTGTTGCCAAGCACACGTCAGCCTTGTGCAATGCCTGCCGCATCGCCTCATCCAAGACGGCCAACCCAGTAGCCAAGAGGCACTTCGTCCAGTCAGCCAAGGAAGTCGCCAACAGCACTGCCAACCTGGTGAAGACCATCAAGGCCCTGGATGGGGATTTCTCTGAAGACAACCGCAATAAGTGTCGCATCGCCACCGCACCCTTGATTGAAGCTGTGGAGAACCTGACAGCGTTCGCCTCAAACCCTGAGTTTGTCAGCATTCCTGCCCAGATCAGCTCCGAGGGTTCCCAGGCACAGGAACCAATCCTGGTCTCAGCCAAGACCATGCTGGAGAGTTCATCGTACCTCATTCGCACTGCACGCTCTCTGGCCATCAACCCCAAAGACCCACCCACCTGGTCTGTACTGGCTGGACATTCCCATACAGTGTCCGACTCCATCAAGAGTCTCATCACTTCTATCAGGGACAAGGCCCCTGGACAGAGGGAGTGTGATTACTCCATCGATGGCATCAACCGGTGCATCCGGGACATCGAGCAGGCCTCGCTGGCCGCCGTCAGCCAGAGCCTGGCCACGAGGGACGACATCTCTGTGGAGGCCCTGCAGGAGCAGCTGACTTCGGTGGTCCAGGAAATCGGACACCTTATCGATCCCATCGCCACAGCGGCTCGGGGAGAAGCAGCTCAGCTGGGACATAAGGTGACACAACTGGCAAGCTATTTTGAGCCCTTGATCTTAGCCGCAGTTGGTGTGGCCTCCAAGATTCTTGATCATCAGCAGCAGATGACGGTGCTGGACCAGACCAAGACTCTCGCAGAGTCTGCCTTGCAGATGTTGTATGCAGCCAAAGAAGGTGGCGGAAACCCCAAGGCACAACACACCCATGACGCCATCACAGAGGCCGCCCAGTTGATGAAGGAAGCCGTGGATGACATCATGGTGACGCTGAACGAAGCTGCCAGTGAAGTGGGGCTGGTTGGGGGCATGGTGGACGCCATTGCAGAAGCCATGAGCAAGCTGGATGAAGGCACTCCTCCAGAACCAAAGGGAACATTTGTCGACTATCAGACGACTGTGGTTAAATACTCCAAAGCCATTGCGGTGACAGCTCAGGAAATGATGACTAAGTCGGTTACTAACCCGGAGGAGTTGGGAGGACTGGCTTCACAAATGACCAGTGACTATGGGCACCTGGCTTTCCAGGGCCAGATGGCAGCAGCCACGGCGGAACCAGAGGAGATCGGATTCCAGATTCGCACTCGTGTGCAGGACCTGGGCCACGGCTGTATCTTCCTGGTGCAGAAGGCAGGGGCCCTCCAGGTCTGCCCCACAGACAGCTACACCAAGAGGGAGCTGATCGAATGCGCCCGTGCCGTCACGGAAAAGGTCTCCTTGGTGCTCTCGGCTCTCCAGGCCGGGAACAAAGGAACCCAGGCATGCATTACAGCCGCCACCGCTGTGTCTGGGATCATTGCCGACCTGGACACCACCATTATGTTTGCAACAGCGGGGACGCTGAATGCAGAGAACAGTGAGACCTTCGCAGACCACAGGGAGAACATTCTCAAGACGGCCAAGGCCTTGGTAGAAGACACGAAACTACTTGTGTCAGGAGCTGCGTCCACTCCTGACAAGCTGGCCCAGGCGGCCCAGTCCTCAGCAGCCACCATCACCCAGCTCGCAGAAGTGGTCAAGCTGGGGGCAGCCAGCCTGGGCTCCGACGACCCCGAGACCCAGGTGGTTTTGATCAATGCCATCAAAGATGTGGCCAAGGCCCTTTCTGATCTCATCAGTGCTACCAAGGGAGCTGCCAGCAAGCCAGTGGACGACCCTTCCATGTACCAGCTCAAGGGGGCTGCCAAGGTGATGGTGACCAATG