Transcript asmbl_58850

Sequence
Transcript Sequence for observation asmbl_58850 of TGE0058671:
AAGAGATCCTCCTGCCGCAGCCTCCTACGGTGCTGGAATTACAGGTGCTGCAGGAGGCTTCTCACATGCTTTGGGATATCTTCAGGGAAATACGCTCTTAATAGAAACTGAGAATTTAAGAAAGTCTGCCTGGCGGAGGACACCTGCACTTGTTACCCTGAGTTGATTCCTGAAACTTCGGACCCCTGGGTATTAACAGAGGACTCAGTGGGAGCTCCTGGTCAGAGGACTTGGATGTTGTCATTACATTCTAAGTGAGACTGTCCACATCATCTAGGAAAATGGTGGCCCTGTCCTTAAAGATTTGTGTGCGCCACTGCAACGTGGTGAAGACCATGCAGTTTGAACCATCTACAGCTGTGTACGATGCGTGTCGAGTCATTCGGGAACGGGTGCCTGAGGCACAAACTGGGCAAGCTTCTGACTATGGACTCTTTCTTTCGGATGAAGACCCGAGGAAAGGGATTTGGCTGGAAGCGGGCAGAACACTGGATTACTACATGTTGCGGAATGGGGATATTTTGGAATATAAAAAGAAACAGAGACCTCAGAAAATCCGGATGCTGGATGGATCTGTGAAGACAGTGATGGTGGATGATTCCAAGACTGTGGGGGAGCTCCTGGTCACTATTTGTAGCAGAATAGGAATAACAAATTATGAAGAATACTCCTTAATCCAAGAAACTATTGAAGAAAAGAAAGAGGAAGGAACGGGCACACTCAAAAAAGACAGGACACTGTTACGAGATGAGAGGAAAATGGAGAAGTTGAAGGCCAAGCTGCACACAGATGATGACCTAAATTGGCTGGATCACAGCCGAACATTCAGAGAACAAGGAGTAGATGAAAACGAAACGTTGCTGCTTAGACGGAAGTTCTTTTACTCTGATCAGAATGTAGATTCGAGAGACCCCGTGCAGCTGAACTTGCTTTATGTTCAGGCACGGGATGACATCCTGAATGGCTCTCACCCTGTCTCCTTCGAGAAAGCTTGTGAGTTTGGTGGATTTCAAGCCCAGATACAATTTGGACCTCATGTGGAACATAAACACAAACCTGGATTTTTAGATCTGAAGGAATTCCTGCCCAAAGAATATATCAAGCAGAGAGGAGCTGAAAAGAGGATCTTTCAGGAGCATAAGAACTGCGGAGAGATGAGTGAGATAGAAGCCAAGGTCAAGTACGTCAAACTCGCACGGTCCCTCCGCACATATGGCGTGTCCTTCTTCCTGGTGAAGGAGAAGATGAAAGGCAAGAACAAGCTGGTGCCTCGCCTGCTGGGGATCACCAAAGACTCGGTGATGCGCGTGGATGAGAAGACCAAGGAAGTGCTGCAGGAGTGGCCCCTCACCACCGTCAAGCGCTGGGCAGCCTCACCCAAGAGCTTCACACTGGATTTTGGGGAGTATCAGGAAAGCTACTATTCAGTACAAACCACCGAGGGAGAGCAGATATCCCAGCTGATTGCAGGCTACATTGACATCATCCTGAAAAAGAAACAAAGTAAAGATCGATTTGGACTAGAAGGTGATGAGGAGTCAACCATGTTAGAAGAGTCCGTTTCCCCAAAAAAGTCCACCATCTTGCAGCAGCAGTTCAACCGGACCGGGAAGGCAGAGCACGGCTCAGTGGCGCTGCCGGCCGTGATGCGCTCGGGCTCCAGCGGGCCTGAGACCTTCAACGTTGGCAGCATGCCCTCGCCACAGCAGCAGGTCATGGTTGGGCAGATGCACCGAGGCCACATGCCGCCACTGACCTCAGCCCAGCAGGCCCTGATGGGGACCATCAACACAAGCATGCACGCCGTCCAGCAGGCCCAGGATGATCTCAGTGAGCTCGACTCGCTGCCACCTCTCGGCCAGGATATGGCATCTAGGGTATGGGTTCAGAACAAAGTCGACGAATCCAAACACGAAATCCATTCTCAAGTTGATGCTATCACGGCCGGAACGGCTTCAGTTGTTAACCTCACAGCTGGTGACCCTGCAGACACTGACTACACAGCTGTGGGATGTGCGATCACCACTATTTCTTCCAACCTGACGGAGATGTCCAAGGGTGTGAAGCTATTGGCCGCCCTCATGGATGATGAGGTGGGCAGCGGGGAGGACTTGCTCAGAGCTGCCAGGACCCTCGCTGGGGCGGTGTCAGACTTGCTGAAAGCTGTGCAGCCTACTTCTGGAGAGCCTCGACAGACAGTTTTGACTGCTGCTGGCAGCATCGGACAAGCCAGTGGGGATCTTCTGAGACAGATTGGAGAGAATGAGACTGATGAGCGATTCCAGGATGTTTTAATGAGTTTGGCCAAAGCTGTTGCCAATGCAGCTGCCATGTTGGTACTAAAGGCAAAGAATGTTGCCCAAGTGGCCGAAGACACTGTCCTACAGAACAGGGTAATTGCTGCTGCCACCCAGTGTGCCCTCTCCACCTCCCAGCTTGTGGCATGTGCCAAGGTTGTGAGCCCCACTATTAGCTCCCCTGTGTGCCAGGAGCAGCTGATTGAAGCAGGGAAGCTGGTGGACCGCTCGGTGGAGAACTGTGTCCGTGCCTGCCAGGCGGCCACTACCGATAGTGAGCTCCTGAAGCAGGTCAGCGCAGCGGCCAGCGTGGTCAGCCAGGCCCTCCATGATCTCCTGCAGCATGTGCGGCAGTTTGCCAGCCGAGGCGAGCCCATCGGCCGCTACGACCAGGCTACTGACACCATCATGTGTGTCACCGAGAGCATCTTCAGCTCCATGGGTGACGCTGGTGAAATGGTGCGCCAGGCGCGGGTTCTGGCCCAAGCCACATCAGACCTCGTCAATGCCATGAGGTCAGATGCAGAAGCCGAAATCGACATGGAGAATTCAAAGAAGCTCCTGGCAGCAGCAAAACTCTTAGCTGACTCCACTGCTCGCATGGTGGAAGCTGCAAAGGGGGCTGCAGCCAACCCAGAGAATGAGGACCAGCAGCAAAGGCTGAGAGAAGCTGCAGAAGGCCTCCGGGTAGCAACCAACGCAGCTGCCCAGAATGCTATTAAGAAAAAAATTGTCAACCGACTGGAGGTTGCAGCCAAGCAGGCCGCAGCGGCAGCCACACAGACCATCGCCGCCTCCCAGAATGCAGCTGTTTCCAACAAGAACCCTGCGGCCCAGCAGCAGCTGGTCCAGAGTTGCAAGGCAGTGGCTGATCACATCCCTCAGCTGGTCCAGGGAGTGAGGGGGAGCCAAGCTCAAGCTGAAGACCTGAGTGCCCAGCTGGCTCTCATCATCTCCAGCCAGAACTTCCTCCAGCCTGGAAGCAAGATGGTGTCCTCTGCCAAAGCCGCAGTGCCCACCGTGAGTGACCAGGCCGCAGCCATGCAGCTGAGCCAGTGTGCCAAGAACCTGGCCACCAGCTTGGCGGAGCTGCGTACCGCCTCGCAGAAGGCCCATGAAGCTTGTGGTCCGATGGAAATCGATTCAGCTCTGAATACGGTGCAGACGCTTAAGAATGAACTGCAGGATGCCAAGATGGCAGCCGTGGAGAGCCAGCTGAAGCCACTTCCAGGGGAAACGCTGGAAAAATGTGCTCAGGACCTGGGAAGCACATCCAAGGCGGTGGGCTCCTCCATGGCACAGCTGCTGACCTGTGCTGCTCAAGGCAACGAACACTACACAGGGGTGGCTGCTAGAGAGACGGCCCAAGCTCTGAAAACACTGGCCCAGGCCGCCCGTGGAGTGGCTGCATCGACAACCGACCCCGCGGCCGCCCATGCCATGTTAGATTCTGCTCGAGACGTGATGGAGGGCTCCGCCATGCTCATTCAAGAGGCCAAGCAGGCCCTGATTGCACCTGGAGATGCAGAGCGTCAACAAAGACTGGCTCAGGTGGCTAAAGCCGTCTCACACTCCTTGAATAACTGCGTAAATTGCCTCCCTGGGCAGAAGGATGTGGACGTGGCCTTGAAGAGCATCGGGGAGTCCAGCAAGAAGCTGCTTGTGGATTCGCTACCTCCAAGCACGAAGCCTTTCCAGGAAGCCCAGAGTGAACTGAACCAGGCAGCAGCTGATCTGAACCAGTCTGCTGGGGAAGTGGTCCATGCCACCCGGGGCCAGAGTGGAGAGTTGGCTGCAGCCTCTGGAAAGTTCAGTGATGATTTTGATGAATTCCTCGATGCTGGCATTGAGATGGCTGGCCAAGCTCAGACAAAAGAAGACCAGATCCAAGTGATAGGGAACCTCAAGAATATCTCGATGGCATCCAGCAAGCTGCTGTTAGCTGCCAAGTCTCTCTCTGTAGATCCAGGAGCTCCCAATGCGAAAAATCTCCTGGCTGCAGCTGCAAGAGCTGTGACAGAGAGCATCAATCAACTCATCACTCTGTGTACCCAACAAGCTCCGGGCCAGAAAGAGTGCGATAATGCCCTGCGGGAGCTCGAGACTGTGAAGGGGATGTTGGACAATCCTAATGAACCTGTTAGTGACCTCTCTTACTTTGACTGCATTGAGAGTGTGATGGAAAACTCCAAGGTTCTGGGTGAATCGATGGCAGGGATTTCACAGAATGCCAAGACCGGAGACCTCCCTGCCTTTGGGGAATGTGTGGGGATTGCATCCAAGGCTCTCTGTGGGCTGACAGAGGCTGCAGCCCAGGCTGCATACTTGGTTGGCATCTCTGATCCAAACAGCCAGGCAGGCCACCAGGGCCTGGTGGACCCCATCCAGTTTGCCAGGGCTAACCAGGCCATCCAGATGGCATGCCAGAACTTGGTGGACCCTGGCAGCAGCCCATCACAGGTCCTGTCAGCCGCCACAATTGTTGCCAAGCACACGTCAGCCTTGTGCAATGCCTGCCGCATCGCCTCATCCAAGACGGCCAACCCAGTAGCCAAGAGGCACTTCGTCCAGTCAGCCAAGGAAGTCGCCAACAGCACTGCCAACCTGGTGAAGACCATCAAGGCCCTGGATGGGGATTTCTCTGAAGACAACCGCAATAAGTGTCGCATCGCCACCGCACCCTTGATTGAAGCTGTGGAGAACCTGACAGCGTTCGCCTCAAACCCTGAGTTTGTCAGCATTCCTGCCCAGATCAGCTCCGAGGGTTCCCAGGCACAGGAACCAATCCTGGTCTCAGCCAAGACCATGCTGGAGAGTTCATCGTACCTCATTCGCACTGCACGCTCTCTGGCCATCAACCCCAAAGACCCACCCACCTGGTCTGTACTGGCTGGACATTCCCATACAGTGTCCGACTCCATCAAGAGTCTCATCACTTCTATCAGGGACAAGGCCCCTGGACAGAGGGAGTGTGATTACTCCATCGATGGCATCAACCGGTGCATCCGGGACATCGAGCAGGCCTCGCTGGCCGCCGTCAGCCAGAGCCTGGCCACGAGGGACGACATCTCTGTGGAGGCCCTGCAGGAGCAGCTGACTTCGGTGGTCCAGGAAATCGGACACCTTATCGATCCCATCGCCACAGCGGCTCGGGGAGAAGCAGCTCAGCTGGGACATAAGGTGACACAACTGGCAAGCTATTTTGAGCCCTTGATCTTAGCCGCAGTTGGTGTGGCCTCCAAGATTCTTGATCATCAGCAGCAGATGACGGTGCTGGACCAGACCAAGACTCTCGCAGAGTCTGCCTTGCAGATGTTGTATGCAGCCAAAGAAGGTGGCGGAAACCCCAAGGCACAACACACCCATGACGCCATCACAGAGGCCGCCCAGTTGATGAAGGAAGCCGTGGATGACATCATGGTGACGCTGAACGAAGCTGCCAGTGAAGTGGGGCTGGTTGGGGGCATGGTGGACGCCATTGCAGAAGCCATGAGCAAGCTGGATGAAGGCACTCCTCCAGAACCAAAGGGAACATTTGTCGACTATCAGACGACTGTGGTTAAATACTCCAAAGCCATTGCGGTGACAGCTCAGGAAATGATGACTAAGTCGGTTACTAACCCGGAGGAGTTGGGAGGACTGGCTTCACAAATGACCAGTGACTATGGGCACCTGGCTTTCCAGGGCCAGATGGCAGCAGCCACGGCGGAACCAGAGGAGATCGGATTCCAGATTCGCACTCGTGTGCAGGACCTGGGCCACGGCTGTATCTTCCTGGTGCAGAAGGCAGGGGCCCTCCAGGTCTGCCCCACAGACAGCTACACCAAGAGGGAGCTGATCGAATGCGCCCGTGCCGTCACGGAAAAGGTCTCCTTGGTGCTCTCGGCTCTCCAGGCCGGGAACAAAGGAACCCAGGCATGCATTACAGCCGCCACCGCTGTGTCTGGGATCATTGCCGACCTGGACACCACCATTATGTTTGCAACAGCGGGGACGCTGAATGCAGAGAACAGTGAGACCTTCGCAGACCACAGGGAGAACATTCTCAAGACGGCCAAGGCCTTGGTAGAAGACACGAAACTACTTGTGTCAGGAGCTGCGTCCACTCCTGACAAGCTGGCCCAGGCGGCCCAGTCCTCAGCAGCCACCATCACCCAGCTCGCAGAAGTGGTCAAGCTGGGGGCAGCCAGCCTGGGCTCCGACGACCCCGAGACCCAGGTGGTTTTGATCAATGCCATCAAAGATGTGGCCAAGGCCCTTTCTGATCTCATCAGTGCTACCAAGGGAGCTGCCAGCAAGCCAGTGGACGACCCTTCCATGTACCAGCTCAAGGGGGCTGCCAAGGTGATGGTGACCAATG