Transcript asmbl_58849

Sequence
Transcript Sequence for observation asmbl_58849 of TGE0058672:
CTTCTGTTTTTCTTCCCATTTATATTTCAGCTTCTGACTATGGACTCTTTCTTTCGGATGAAGACCCGAGGAAAGGGATTTGGCTGGAAGCGGGCAGAACACTGGATTACTACATGTTGCGGAATGGGGATATTTTGGAATATAAAAAGAAACAGAGACCTCAGAAAATCCGGATGCTGGATGGATCTGTGAAGACAGTGATGGTGGATGATTCCAAGACTGTGGGGGAGCTCCTGGTCACTATTTGTAGCAGAATAGGAATAACAAATTATGAAGAATACTCCTTAATCCAAGAAACTATTGAAGAAAAGAAAGAGGAAGGAACGGGCACACTCAAAAAAGACAGGACACTGTTACGAGATGAGAGGAAAATGGAGAAGTTGAAGGCCAAGCTGCACACAGATGATGACCTAAATTGGCTGGATCACAGCCGAACATTCAGAGAACAAGGAGTAGATGAAAACGAAACGTTGCTGCTTAGACGGAAGTTCTTTTACTCTGATCAGAATGTAGATTCGAGAGACCCCGTGCAGCTGAACTTGCTTTATGTTCAGGCACGGGATGACATCCTGAATGGCTCTCACCCTGTCTCCTTCGAGAAAGCTTGTGAGTTTGGTGGATTTCAAGCCCAGATACAATTTGGACCTCATGTGGAACATAAACACAAACCTGGATTTTTAGATCTGAAGGAATTCCTGCCCAAAGAATATATCAAGCAGAGAGGAGCTGAAAAGAGGATCTTTCAGGAGCATAAGAACTGCGGAGAGATGAGTGAGATAGAAGCCAAGGTCAAGTACGTCAAACTCGCACGGTCCCTCCGCACATATGGCGTGTCCTTCTTCCTGGTGAAGGAGAAGATGAAAGGCAAGAACAAGCTGGTGCCTCGCCTGCTGGGGATCACCAAAGACTCGGTGATGCGCGTGGATGAGAAGACCAAGGAAGTGCTGCAGGAGTGGCCCCTCACCACCGTCAAGCGCTGGGCAGCCTCACCCAAGAGCTTCACACTGGATTTTGGGGAGTATCAGGAAAGCTACTATTCAGTACAAACCACCGAGGGAGAGCAGATATCCCAGCTGATTGCAGGCTACATTGACATCATCCTGAAAAAGAAACAAAGTAAAGATCGATTTGGACTAGAAGGTGATGAGGAGTCAACCATGTTAGAAGAGTCCGTTTCCCCAAAAAAGTCCACCATCTTGCAGCAGCAGTTCAACCGGACCGGGAAGGCAGAGCACGGCTCAGTGGCGCTGCCGGCCGTGATGCGCTCGGGCTCCAGCGGGCCTGAGACCTTCAACGTTGGCAGCATGCCCTCGCCACAGCAGCAGGTCATGGTTGGGCAGATGCACCGAGGCCACATGCCGCCACTGACCTCAGCCCAGCAGGCCCTGATGGGGACCATCAACACAAGCATGCACGCCGTCCAGCAGGCCCAGGATGATCTCAGTGAGCTCGACTCGCTGCCACCTCTCGGCCAGGATATGGCATCTAGGGTATGGGTTCAGAACAAAGTCGACGAATCCAAACACGAAATCCATTCTCAAGTTGATGCTATCACGGCCGGAACGGCTTCAGTTGTTAACCTCACAGCTGGTGACCCTGCAGACACTGACTACACAGCTGTGGGATGTGCGATCACCACTATTTCTTCCAACCTGACGGAGATGTCCAAGGGTGTGAAGCTATTGGCCGCCCTCATGGATGATGAGGTGGGCAGCGGGGAGGACTTGCTCAGAGCTGCCAGGACCCTCGCTGGGGCGGTGTCAGACTTGCTGAAAGCTGTGCAGCCTACTTCTGGAGAGCCTCGACAGACAGTTTTGACTGCTGCTGGCAGCATCGGACAAGCCAGTGGGGATCTTCTGAGACAGATTGGAGAGAATGAGACTGATGAGCGATTCCAGGATGTTTTAATGAGTTTGGCCAAAGCTGTTGCCAATGCAGCTGCCATGTTGGTACTAAAGGCAAAGAATGTTGCCCAAGTGGCCGAAGACACTGTCCTACAGAACAGGGTAATTGCTGCTGCCACCCAGTGTGCCCTCTCCACCTCCCAGCTTGTGGCATGTGCCAAGGTTGTGAGCCCCACTATTAGCTCCCCTGTGTGCCAGGAGCAGCTGATTGAAGCAGGGAAGCTGGTGGACCGCTCGGTGGAGAACTGTGTCCGTGCCTGCCAGGCGGCCACTACCGATAGTGAGCTCCTGAAGCAGGTCAGCGCAGCGGCCAGCGTGGTCAGCCAGGCCCTCCATGATCTCCTGCAGCATGTGCGGCAGTTTGCCAGCCGAGGCGAGCCCATCGGCCGCTACGACCAGGCTACTGACACCATCATGTGTGTCACCGAGAGCATCTTCAGCTCCATGGGTGACGCTGGTGAAATGGTGCGCCAGGCGCGGGTTCTGGCCCAAGCCACATCAGACCTCGTCAATGCCATGAGGTCAGATGCAGAAGCCGAAATCGACATGGAGAATTCAAAGAAGCTCCTGGCAGCAGCAAAACTCTTAGCTGACTCCACTGCTCGCATGGTGGAAGCTGCAAAGGGGGCTGCAGCCAACCCAGAGAATGAGGACCAGCAGCAAAGGCTGAGAGAAGCTGCAGAAGGCCTCCGGGTAGCAACCAACGCAGCTGCCCAGAATGCTATTAAGAAAAAAATTGTCAACCGACTGGAGGTTGCAGCCAAGCAGGCCGCAGCGGCAGCCACACAGACCATCGCCGCCTCCCAGAATGCAGCTGTTTCCAACAAGAACCCTGCGGCCCAGCAGCAGCTGGTCCAGAGTTGCAAGGCAGTGGCTGATCACATCCCTCAGCTGGTCCAGGGAGTGAGGGGGAGCCAAGCTCAAGCTGAAGACCTGAGTGCCCAGCTGGCTCTCATCATCTCCAGCCAGAACTTCCTCCAGCCTGGAAGCAAGATGGTGTCCTCTGCCAAAGCCGCAGTGCCCACCGTGAGTGACCAGGCCGCAGCCATGCAGCTGAGCCAGTGTGCCAAGAACCTGGCCACCAGCTTGGCGGAGCTGCGTACCGCCTCGCAGAAGGCCCATGAAGCTTGTGGTCCGATGGAAATCGATTCAGCTCTGAATACGGTGCAGACGCTTAAGAATGAACTGCAGGATGCCAAGATGGCAGCCGTGGAGAGCCAGCTGAAGCCACTTCCAGGGGAAACGCTGGAAAAATGTGCTCAGGACCTGGGAAGCACATCCAAGGCGGTGGGCTCCTCCATGGCACAGCTGCTGACCTGTGCTGCTCAAGGCAACGAACACTACACAGGGGTGGCTGCTAGAGAGACGGCCCAAGCTCTGAAAACACTGGCCCAGGCCGCCCGTGGAGTGGCTGCATCGACAACCGACCCCGCGGCCGCCCATGCCATGTTAGATTCTGCTCGAGACGTGATGGAGGGCTCCGCCATGCTCATTCAAGAGGCCAAGCAGGCCCTGATTGCACCTGGAGATGCAGAGCGTCAACAAAGACTGGCTCAGGTGGCTAAAGCCGTCTCACACTCCTTGAATAACTGCGTAAATTGCCTCCCTGGGCAGAAGGATGTGGACGTGGCCTTGAAGAGCATCGGGGAGTCCAGCAAGAAGCTGCTTGTGGATTCGCTACCTCCAAGCACGAAGCCTTTCCAGGAAGCCCAGAGTGAACTGAACCAGGCAGCAGCTGATCTGAACCAGTCTGCTGGGGAAGTGGTCCATGCCACCCGGGGCCAGAGTGGAGAGTTGGCTGCAGCCTCTGGAAAGTTCAGTGATGATTTTGATGAATTCCTCGATGCTGGCATTGAGATGGCTGGCCAAGCTCAGACAAAAGAAGACCAGATCCAAGTGATAGGGAACCTCAAGAATATCTCGATGGCATCCAGCAAGCTGCTGTTAGCTGCCAAGTCTCTCTCTGTAGATCCAGGAGCTCCCAATGCGAAAAATCTCCTGGCTGCAGCTGCAAGAGCTGTGACAGAGAGCATCAATCAACTCATCACTCTGTGTACCCAACAAGCTCCGGGCCAGAAAGAGTGCGATAATGCCCTGCGGGAGCTCGAGACTGTGAAGGGGATGTTGGACAATCCTAATGAACCTGTTAGTGACCTCTCTTACTTTGACTGCATTGAGAGTGTGATGGAAAACTCCAAGGTTCTGGGTGAATCGATGGCAGGGATTTCACAGAATGCCAAGACCGGAGACCTCCCTGCCTTTGGGGAATGTGTGGGGATTGCATCCAAGGCTCTCTGTGGGCTGACAGAGGCTGCAGCCCAGGCTGCATACTTGGTTGGCATCTCTGATCCAAACAGCCAGGCAGGCCACCAGGGCCTGGTGGACCCCATCCAGTTTGCCAGGGCTAACCAGGCCATCCAGATGGCATGCCAGAACTTGGTGGACCCTGGCAGCAGCCCATCACAGGTCCTGTCAGCCGCCACAATTGTTGCCAAGCACACGTCAGCCTTGTGCAATGCCTGCCGCATCGCCTCATCCAAGACGGCCAACCCAGTAGCCAAGAGGCACTTCGTCCAGTCAGCCAAGGAAGTCGCCAACAGCACTGCCAACCTGGTGAAGACCATCAAGGCCCTGGATGGGGATTTCTCTGAAGACAACCGCAATAAGTGTCGCATCGCCACCGCACCCTTGATTGAAGCTGTGGAGAACCTGACAGCGTTCGCCTCAAACCCTGAGTTTGTCAGCATTCCTGCCCAGATCAGCTCCGAGGGTTCCCAGGCACAGGAACCAATCCTGGTCTCAGCCAAGACCATGCTGGAGAGTTCATCGTACCTCATTCGCACTGCACGCTCTCTGGCCATCAACCCCAAAGACCCACCCACCTGGTCTGTACTGGCTGGACATTCCCATACAGTGTCCGACTCCATCAAGAGTCTCATCACTTCTATCAGGGACAAGGCCCCTGGACAGAGGGAGTGTGATTACTCCATCGATGGCATCAACCGGTGCATCCGGGACATCGAGCAGGCCTCGCTGGCCGCCGTCAGCCAGAGCCTGGCCACGAGGGACGACATCTCTGTGGAGGCCCTGCAGGAGCAGCTGACTTCGGTGGTCCAGGAAATCGGACACCTTATCGATCCCATCGCCACAGCGGCTCGGGGAGAAGCAGCTCAGCTGGGACATAAGGTGACACAACTGGCAAGCTATTTTGAGCCCTTGATCTTAGCCGCAGTTGGTGTGGCCTCCAAGATTCTTGATCATCAGCAGCAGATGACGGTGCTGGACCAGACCAAGACTCTCGCAGAGTCTGCCTTGCAGATGTTGTATGCAGCCAAAGAAGGTGGCGGAAACCCCAAGGCACAACACACCCATGACGCCATCACAGAGGCCGCCCAGTTGATGAAGGAAGCCGTGGATGACATCATGGTGACGCTGAACGAAGCTGCCAGTGAAGTGGGGCTGGTTGGGGGCATGGTGGACGCCATTGCAGAAGCCATGAGCAAGCTGGATGAAGGCACTCCTCCAGAACCAAAGGGAACATTTGTCGACTATCAGACGACTGTGGTTAAATACTCCAAAGCCATTGCGGTGACAGCTCAGGAAATGATGACTAAGTCGGTTACTAACCCGGAGGAGTTGGGAGGACTGGCTTCACAAATGACCAGTGACTATGGGCACCTGGCTTTCCAGGGCCAGATGGCAGCAGCCACGGCGGAACCAGAGGAGATCGGATTCCAGATTCGCACTCGTGTGCAGGACCTGGGCCACGGCTGTATCTTCCTGGTGCAGAAGGCAGGGGCCCTCCAGGTCTGCCCCACAGACAGCTACACCAAGAGGGAGCTGATCGAATGCGCCCGTGCCGTCACGGAAAAGGTCTCCTTGGTGCTCTCGGCTCTCCAGGCCGGGAACAAAGGAACCCAGGCATGCATTACAGCCGCCACCGCTGTGTCTGGGATCATTGCCGACCTGGACACCACCATTATGTTTGCAACAGCGGGGACGCTGAATGCAGAGAACAGTGAGACCTTCGCAGACCACAGGGAGAACATTCTCAAGACGGCCAAGGCCTTGGTAGAAGACACGAAACTACTTGTGTCAGGAGCTGCGTCCACTCCTGACAAGCTGGCCCAGGCGGCCCAGTCCTCAGCAGCCACCATCACCCAGCTCGCAGAAGTGGTCAAGCTGGGGGCAGCCAGCCTGGGCTCCGACGACCCCGAGACCCAGGTGGTTTTGATCAATGCCATCAAAGATGTGGCCAAGGCCCTTTCTGATCTCATCAGTGCTACCAAGGGAGCTGCCAGCAAGCCAGTGGACGACCCTTCCATGTACCAGCTCAAGGGGGCTGCCAAGGTGATGGTGACCAATG