Transcript asmbl_58750

Sequence
Transcript Sequence for observation asmbl_58750 of TGE0058670:
AGCGGCTGCCACACAGCGGCCCAAGCCGGGTTTGGGGGTTGGGACCTCCGGCTGCAGGTCCGCCTGGGCCAGACGCGCGAGCGCAAGCAGCGGGTTAGTGGTCGCGCGCCCGACCTCCGCAGTCCCAGCCGAGCCGCGACCCTTCCGGCCGTCCCCACCCCACCTCGCCGCCATGCGCCTCCGCCGCCTAGCGCTGTTCCCGGGTGTGGCGCTGCTTCTTGCCGCGGCCCGCCTCGCCGCTGCCTCCGACGTGCTAGAACTCACGGACGACAACTTCGAGAGTCGCATCTCCGACACGGGCTCTGCGGGCCTCATGCTCGTCGAGTTCTTCGCCCCCTGGTGTGGACACTGCAAGAGACTTGCACCTGAGTATGAAGCTGCAGCTACCAGATTAAAAGGAATAGTCCCATTAGCAAAGGTTGATTGCACTGCCAACACTAACACCTGTAATAAATATGGAGTCAGTGGATATCCAACCCTGAAGATATTTAGAGATGGTGAAGAAGCAGGTGCTTATGATGGACCTAGGACTGCTGATGGAATTGTCAGCCACTTGAAGAAGCAGGCAGGACCAGCTTCAGTGCCTCTCAGGACTGAGGAAGAATTTAAGAAATTCATTAGTGATAAAGATGCCTCTATAGTAGGTTTTTTCGATGATTCATTCAGTGAGGCTCACTCCGAGTTCCTAAAAGCAGCCAGCAACTTGAGGGATAACTACCGATTTGCACATACGAATGTTGAGTCTCTGGTGAACGAGTATGATGATAATGGAGAGGGTATCATCTTATTTCGTCCTTCACATCTCACTAACAAGTTTGAGGACAAGACTGTGGCATATACAGAGCAAAAAATGACCAGTGGCAAAATTAAAAAGTTTATCCAGGAAAACATTTTTGGTATCTGCCCTCACATGACAGAAGACAATAAAGATTTGATACAGGGCAAGGACTTACTTATTGCTTACTATGATGTGGACTATGAAAAGAACGCTAAAGGTTCCAACTACTGGAGAAACAGGGTAATGATGGTGGCAAAGAAATTCCTGGATGCTGGGCACAAACTCAACTTTGCTGTAGCTAGCCGCAAAACCTTTAGCCATGAACTTTCTGATTTTGGCTTGGAGAGCACTGCTGGAGAGATTCCTGTTGTTGCTATCAGAACTGCTAAAGGAGAGAAGTTTGTCATGCAGGAGGAGTTCTCGCGTGATGGGAAGGCTCTGGAGAGGTTCCTGCAGGATTACTTTGATGGCAATCTGAAGAGATACCTGAAGTCTGAACCTATCCCAGAGAGCAATGATGGGCCTGTGAAGGTAGTGGTAGCAGAGAATTTTGATGAAATAGTGAATAATGAAAATAAAGATGTGCTGATTGAATTTTATGCCCCTTGGTGTGGTCACTGTAAGAACCTGGAGCCCAAGTATAAAGAACTTGGCGAGAAGCTCAGCAAAGACCCAAATATCGTCATAGCCAAGATGGATGCCACAGCCAATGATGTGCCTTCTCCATATGAAGTCAGAGGTTTTCCTACCATATACTTCTCTCCAGCCAACAAGAAGCTAAATCCAAAGAAATATGAAGGTGGCCGTGAATTAAGTGATTTTATTAGCTATCTACAAAGAGAAGCTACAAACCCCCCTGTAATTCAAGAAGAAAAACCCAAGAAGAAGAAGAAGGCACAGGAGGATCTCTAAAGCAGTAGCCAAACACCACTTTGTAAAAGGACTCTTCCATCAGAGATGGGAAAACCATTGGGGAGGACTAGGACCCATATGGGAATTATTACCTCTCAGGGCCGAGAGGACAGAATGGATATAATCTGAATCCTGTTAAATTTTCTCTAAACTGTTTCTTAGCTGCACTGTTTATGGAAATACCAGGACCAGTTTATGTTTGTGGTTTTGGGAAAAATTATTTGTGTTGGGGGAAATGTTGTGGGGGTGGGGTTGAGTTGGGGGTATTTTCTAATTTTTTTTGTACATTTGGAACAGTGACAATAAATGAGACCCCTTTAAACTGTCTTATTTTCCACCAGATTGAGAACCAGATGTTCTCTACACACTATCACTGTTCAATAGAGCTTTCTTCAGTGATGGAAATGCTCTGTAATCTACACTGTTCAGTACAGGTAGCTACGGAGCATCTGAAATATGGCTAGAAACTACATTTTTGTTTTGATTAATTTAAATAGCCATACAGTTGCTACCATACTGGTCACGGCAGCTGTAGACTGACTGGGTCCATAGTTCATCACCTCAAAATTCTTTCAAAATTTATTATCTCTTTCTCTCCTTACATGTTTATTTCCCAGGCCTACCCTGGTGATTAGAACAGCTGAAGGGCCTTTCTTGTTAGGCTGTCCATGCCCTAAGGATGGGTTCCTGTTTATCCTTGCCACGCAGCTGAGCTTACTGCATGTTTATATCTCCCAAGGACTGTTCTCTGCTCAGAAATGCCCTGTCAAGGGTGTGGCATCACGCAGTTTCATCCAAGTTGTTTCAGGAATTGCTGACACTGCTGGGTGCAGTTCTATCCCCTAAAGCCTAGGGTGTGGCCCTTTAACTTCCCCTTCAGTAGAACTGGGAAAGGCAGTACCATTCCTAGTTATGAGTGAAGCATCCACTTTCTTTTGTAACAATGAGGAACAGAAAGGATAAGACTGAAGAGTGATCTTTTGTCCAACTAAACCATTTATCTCCTTTTGTAGGTAAATTCAAATCCTGCCCAGTTATAGTTTTCAGTCACTGGAGAATTCCAGGTAGGAGCCCTACTTTAGGTGATCCTAGGAACTCCTATGTTCAGAAAAGAATTTTCTTCCTACTATATAATTACAGTATTTAGCTGTCAATTTTAAGATGAATTTGGTAGAGCCTTATAGTAAAGTATGTATCTTGGTCACACACAAAGCTTGGAAAAAGTAAAAGATGTCTAAACCATAATCTTGTAACTCATAACATCTGGGCTGGGGCCCGGGGATCTAATTGTTTAGAGAGCCCCAAAAGTGGCTCAGATGTAAAGCCAGGGTTAAGAACCATCTGCCTTGGAAGATTTAAGGGAAACATATAAACTTGTACAAAGGACACAGAAGCAGTCAGTTTTAATTTTTTAGCCATGTTGGTAAAAGTTCATTTTCAGTACATGGGTAACACCCAGGCCCTTTCCCATTATATCCAGGTATGCTACAAGTTCTTTTAACTCTTATCAGAAGTTATTATTACTGTTTCCTTAGAGAGGCTACCAGGCTAAAATTCACTTAGTTTGGTTTGTCTAATGTCCTCATTATTTTATCCTGAAGATGATGTCATTTCTCAGGACTTGAAAATGACTTGGCTGAACTAAAGGTAAAAAAGCCAAGCCTCTGTCACTTTTCCTAGACTCCTAGGCACAGCTATGGAGTCTTTGCACAGTGCCCATACCCTAAAAATTAATAATGAAAACCAAACCTCAAGAACCTAGAGCAGCTCTCTACTTGCCACCATGGACTCCAGTGGTCAGCATAAGAAAAGCAGATAGTTGCATTCTATTTAGTTTATAGCTGCTTTGTTCCTTTGTGTTTCACTAAGCAGAGGCTCAAAAATTCCCTTGATAACTTCAGCTGCCCCTGTTCTTTTCCTCAAACTCCAGGATGAGACCTTTAATGTGGGACAATTTCTGGTGAAGGTACTCACAGCGACGCTTTTCTTCTCTGTAACTTGGGTACTGCTGCAGAGAAAAAGCATCCATGTCAAAAAGTAAAAATTCTCATTCT