Transcript asmbl_58620

Sequence
Transcript Sequence for observation asmbl_58620 of TGE0058664:
CTCTCTCTCTCTCTCTCTCTCTCATGCTCTCTGGAAAGTAATCCTGTTGTCCTTCATTTCAGCAAACGCGGGGTCAAAGAGGGATGGTCCCGGCCCTGTCCCCATGCCCAGCCCCGTTTCTGCGCACCGTCCCTCCCTGCCTAGCTGATCTCTGACCCTCGGCTCTTGTGCTTCCTGCTACAGGATCCCTGCTGGGCACCAACAGCTCCACCATGGGGCTGGCCTGGGGACTAGGCGTCCTGTTCCTGATGCATGTGTGTGGCACCAACCGCATTCCAGAGTCTGGCGGAGACAACAGCGTGTTTGACATCTTTGAACTCACCGGGGCCGCCCGCAAGGGGTCTGGGCGCCGACTGGTGAAGGGCCCCGACCCTTCCAGCCCAGCTTTCCGCATCGAGGATGCCAACCTGATCCCCCCTGTGCCTGATGACAAGTTCCAAGACCTGGTGGATGCTGTGCGGGCAGAAAAGGGTTTCCTCCTTCTGGCATCCCTGAGGCAGATGAAGAAGACCCGGGGCACGCTGCTGGCCCTGGAGCGGAAAGACCACTCTGGCCAGGTCTTCAGCGTGGTGTCCAATGGCAAGGCGGGCACCCTGGACCTCAGCCTGACCGTCCAAGGAAAGCAGCACGTGGTGTCTGTGGAAGAAGCTCTCCTGGCAACCGGCCAGTGGAAGAGCATCACCCTGTTTGTGCAGGAAGACAGGGCCCAGCTGTACATCGACTGTGAAAAGATGGAGAATGCTGAGTTGGACGTCCCCATCCAAAGCGTCTTCACCAGAGACCTGGCCAGCATCGCCAGACTCCGCATCGCAAAGGGGGGCGTCAATGACAATTTCCAGGTGAGGCTTCTTCTCTGAGCCCTGCTCCGTGGGATCATCTGCTAGACAGGTGACCTGCCAGGAGGGCTACAGGAAATCCTGTCTGTAAACTAACGCAGCAGTTCTCAGATTTTAGGCAGCATGAGCATCACCTGGAGGGCTTGTGAAAGCTCACCCTGCTGCACCCCAGCCCCAGAGTCTGGGATTCTGTAAAACTGCAACTCTAACAAGTACCAGGTGATGCTGATGCCGGTGGTCTGGGAAGCACACTTTGAAAACTACTCAAGGAAACAAGAAATGGTTTTCCTTTAGCAGTCAGCCTGTTCAAGCCTTAGATACTCCTTAGGCTCTTAAGAAAAGAGCTTATTTCAAATGCATTCCCCCAATTTTAATCTTGTTTGAAATGGATACTTTCTATGGGCAGAATCAGTACCACTTTGCTATTGGATTCCTCATGGGGATGCAGCTGGTCTCACATAAAAGGTTAAAATAGCAGTTAGTTGTTGCTGTTACAGCTTCATCTGTGCCTTAACTTCTAGATCTTTGCAACGGTGGCTTTGAACTCCCACATTTAACTCTTTGACACTGGAAAGTGTCATTATATCCTCTAGGCTTAGGATCAGATTCCATTTCCTGTGTACCCAAGTAGGCTGATAACTGAATTCTTTGTAAAATACTCAAGACTTGGCAGAAGTCACAATTAAGATTTTGAAGTTGTTTGGCGATTAATGTTGCTGTGTTATTTTGACATAGTGATCTTAAGACAGCTCTTTGAAGCTTTTAGAACATCTATTGTATGCTTTTCCTAGCATACAGACAGTCTCCCCCAACCCCATCCCCACCCCGCTCTGCATTCTACAAGTAATGTGTGTCCTCTGCCCACAGGGGGTGCTGCAGAATGTGAGGTTTGTCTTTGGAACCACACCAGAAGACATCCTCAGGAACAAAGGCTGCTCCAGCTCTACCAGTGTCCTCCTCACCCTTGACAACAACGTGGTGAATGGTTCCAGCCCTGCCATCCGCACTAACTACATTGGCCACAAGACAAAGGACTTGCAAGCCATCTGCGGCATCTCCTGTGATGAGCTGTCCAGCATGGTCCTGGAACTCAGGGGCCTGCGCACCATTGTGACCACGCTGCAGGACAGCATCCGCAAAGTGGTCAGTGGCCTCTGCACCCAGCCCGTTAGCATGAACCCTGGAAGGTTTATCGCAGATGGTCCCAAATGACTGAAAATGCGGGGGGACACTAATGATATTCTCTCCCATTTAGACTGAAGAGAACAAAGAGTTGGCCAATGAGCTGAGGCGGCCTCCCCTATGCTATCACAACGGAGTTCAGTACAGAAATAACGAGGAATGGACTGTTGATAGCTGCACTGAGTGTCACTGTCAGAACTCAGTTACCATCTGCAAAAAGGTGTCCTGCCCCATCATGCCCTGCTCCAATGCCACAGTTCCTGATGGAGAATGCTGTCCTCGCTGTTGGCCCAGCGACTCTGCGGACGATGGCTGGTCTCCATGGTCCGAGTGGACCTCCTGTTCTACGAGCTGTGGCAATGGAATTCAGCAGCGCGGCCGCTCCTGCGATAGCCTCAACAACCGATGTGAGGGCTCCTCGGTCCAGACACGGACCTGCCACATTCAGGAGTGTGACAAGAGATTTAAACAGGATGGTGGCTGGAGCCACTGGTCCCCGTGGTCATCTTGTTCTGTGACATGTGGTGATGGTGTGATCACAAGGATCCGGCTCTGCAACTCTCCCAGCCCCCAGATGAACGGGAAACCCTGTGAAGGCGAAGCGCGGGAGACCAAAGCCTGCAAGAAAGACGCCTGCCCCATCAATGGAGGCTGGGGTCCTTGGTCACCATGGGACATCTGTTCTGTCACCTGTGGAGGAGGGGTACAGAAACGTAGTCGTCTCTGCAACAACCCCACACCCCAGTTTGGAGGCAAGGACTGCGTTGGTGATGTAACAGAAAACCAGATCTGCAACAAGCAGGACTGTCCAATTGATGGATGCCTGTCCAATCCCTGCTTTGCCGGCGTGAAGTGTACTAGCTACCCTGATGGCAGCTGGAAATGTGGTGCTTGTCCCCCTGGTTACAGTGGAAATGGCATCCAGTGCACAGATGTTGATGAGTGCAAAGAAGTGCCTGATGCCTGCTTCAACCACAATGGAGAGCACCGGTGTGAGAACACGGACCCCGGCTACAACTGCCTGCCCTGCCCCCCACGCTTCACCGGCTCACAGCCCTTCGGCCAGGGTGTCGAACATGCCACGGCCAACAAACAGGTGTGCAAGCCCCGTAACCCCTGCACGGATGGGACCCACGACTGCAACAAGAACGCCAAGTGCAACTACCTGGGCCACTATAGCGACCCCATGTACCGCTGCGAGTGCAAGCCTGGCTACGCTGGCAATGGCATCATCTGCGGGGAGGACACAGACCTGGATGGCTGGCCCAATGAGAACCTGGTGTGCGTGGCCAATGCGACTTACCACTGCAAAAAGGTAGAGCCAGGTCCTTTGTGTGCCTCCAGAAAGAGGGCCCATCACCTTATCAAAACACAGGCTAAGGAATTTTAAATACTTAAAGTTTGGACATGAAACTGAAAGATTAAATCTCCCAAAGGGAGAGGGGCACTAATTCCTATTAAAATTAAATCACTTGGTGCCAAAAACATGAACAGGGCTAGCTCTTTTTGGGCAACTGTGTTCCATAGTCAACTCTTCTGTCCAAAAAAAAGTTCAGTACTCTATCCAAATACCAGCAAAGCATGACTTGTGTTCACAACATCTATAAAGCCTAGAGCATTTACACAAATTCTGTATGTATATCCCCCAAGAAAAGTTTTATTTTCTTGTCTTCCCATAAAAAAAATATGCTGTTACTGAGCCAAATTCTGTTCTTTTTCTATTTGGAATTCCAGGTACACTCCCTCGTGCATGAGCTCAGCATGAGGAAGGCAACTGAAGCAGTGATATATATCTTCTCTTTCCTAGGATAATTGCCCCAACCTTCCCAACTCAGGGCAGGAAGACTATGACAAGGATGGAATTGGTGATGCCTGTGATGATGACGATGACAATGATAAAATTCCAGATGACAGGGTAAAAACAGTTTTCTATCCCTTTTTCATCTTTTCAGTTCAGCAACAGCCTGAAACACTTTGGGATTCAAGGAAATTACATGGCTATAGCAAAAAATATACCAAATCAATACACAGGATAATTAGAAATTATTCATTGTGTTCCAGTAGTTTAAGGATGTAGATGTTGCCAAGAGAATTTTTAAATGAGGGTTTTGTTTTTCATCAGAACTGTTTTTCTCTGTACTTGAGAAATTATAATGCATAAACAAATGCCACTTTGTTCCCTAGATTCATTTCAAATGTCACATCGAAATTACAGTAAAATTGACTTTGGGCACACTATGAACTGAGATGATG