Transcript asmbl_58619

Sequence
Transcript Sequence for observation asmbl_58619 of TGE0058664:
CTCTCTCTCTCTCTCTCTCTCTCATGCTCTCTGGAAAGTAATCCTGTTGTCCTTCATTTCAGCAAACGCGGGGTCAAAGAGGGATGGTCCCGGCCCTGTCCCCATGCCCAGCCCCGTTTCTGCGCACCGTCCCTCCCTGCCTAGCTGATCTCTGACCCTCGGCTCTTGTGCTTCCTGCTACAGGATCCCTGCTGGGCACCAACAGCTCCACCATGGGGCTGGCCTGGGGACTAGGCGTCCTGTTCCTGATGCATGTGTGTGGCACCAACCGCATTCCAGAGTCTGGCGGAGACAACAGCGTGTTTGACATCTTTGAACTCACCGGGGCCGCCCGCAAGGGGTCTGGGCGCCGACTGGTGAAGGGCCCCGACCCTTCCAGCCCAGCTTTCCGCATCGAGGATGCCAACCTGATCCCCCCTGTGCCTGATGACAAGTTCCAAGACCTGGTGGATGCTGTGCGGGCAGAAAAGGGTTTCCTCCTTCTGGCATCCCTGAGGCAGATGAAGAAGACCCGGGGCACGCTGCTGGCCCTGGAGCGGAAAGACCACTCTGGCCAGGTCTTCAGCGTGGTGTCCAATGGCAAGGCGGGCACCCTGGACCTCAGCCTGACCGTCCAAGGAAAGCAGCACGTGGTGTCTGTGGAAGAAGCTCTCCTGGCAACCGGCCAGTGGAAGAGCATCACCCTGTTTGTGCAGGAAGACAGGGCCCAGCTGTACATCGACTGTGAAAAGATGGAGAATGCTGAGTTGGACGTCCCCATCCAAAGCGTCTTCACCAGAGACCTGGCCAGCATCGCCAGACTCCGCATCGCAAAGGGGGGCGTCAATGACAATTTCCAGGTGAGGCTTCTTCTCTGAGCCCTGCTCCGTGGGATCATCTGCTAGACAGGTGACCTGCCAGGAGGGCTACAGGAAATCCTGTCTGTAAACTAACGCAGCAGTTCTCAGATTTTAGGCAGCATGAGCATCACCTGGAGGGCTTGTGAAAGCTCACCCTGCTGCACCCCAGCCCCAGAGTCTGGGATTCTGTAAAACTGCAACTCTAACAAGTACCAGGTGATGCTGATGCCGGTGGTCTGGGAAGCACACTTTGAAAACTACTCAAGGAAACAAGAAATGGTTTTCCTTTAGCAGTCAGCCTGTTCAAGCCTTAGATACTCCTTAGGCTCTTAAGAAAAGAGCTTATTTCAAATGCATTCCCCCAATTTTAATCTTGTTTGAAATGGATACTTTCTATGGGCAGAATCAGTACCACTTTGCTATTGGATTCCTCATGGGGATGCAGCTGGTCTCACATAAAAGGTTAAAATAGCAGTTAGTTGTTGCTGTTACAGCTTCATCTGTGCCTTAACTTCTAGATCTTTGCAACGGTGGCTTTGAACTCCCACATTTAACTCTTTGACACTGGAAAGTGTCATTATATCCTCTAGGCTTAGGATCAGATTCCATTTCCTGTGTACCCAAGTAGGCTGATAACTGAATTCTTTGTAAAATACTCAAGACTTGGCAGAAGTCACAATTAAGATTTTGAAGTTGTTTGGCGATTAATGTTGCTGTGTTATTTTGACATAGTGATCTTAAGACAGCTCTTTGAAGCTTTTAGAACATCTATTGTATGCTTTTCCTAGCATACAGACAGTCTCCCCCAACCCCATCCCCACCCCGCTCTGCATTCTACAAGTAATGTGTGTCCTCTGCCCACAGGGGGTGCTGCAGAATGTGAGGTTTGTCTTTGGAACCACACCAGAAGACATCCTCAGGAACAAAGGCTGCTCCAGCTCTACCAGTGTCCTCCTCACCCTTGACAACAACGTGGTGAATGGTTCCAGCCCTGCCATCCGCACTAACTACATTGGCCACAAGACAAAGGACTTGCAAGCCATCTGCGGCATCTCCTGTGATGAGCTGTCCAGCATGGTCCTGGAACTCAGGGGCCTGCGCACCATTGTGACCACGCTGCAGGACAGCATCCGCAAAGTGGTCAGTGGCCTCTGCACCCAGCCCGTTAGCATGAACCCTGGAAGGTTTATCGCAGATGGTCCCAAATGACTGAAAATGCGGGGGGACACTAATGATATTCTCTCCCATTTAGACTGAAGAGAACAAAGAGTTGGCCAATGAGCTGAGGCGGCCTCCCCTATGCTATCACAACGGAGTTCAGTACAGAAATAACGAGGAATGGACTGTTGATAGCTGCACTGAGTGTCACTGTCAGAACTCAGTTACCATCTGCAAAAAGGTGTCCTGCCCCATCATGCCCTGCTCCAATGCCACAGTTCCTGATGGAGAATGCTGTCCTCGCTGTTGGCCTAGATGTGATTGTAGCCGTGGTGCCTGGGCAGATGGTAAACAAACATGCTGTCCTCTTATGACAATATGTGCAGAGAAGGCCCCAAACGCTGGGGTGAGAGGAACAACAAACTGACTAACTCACGGCCGAGTTGGAGCCAGAACCAACAACAGCTCGGCTGCCTTCACACTCATCTGTCAAACACATGGTGTATGGCTCCCCTGACAGAAATGACTCCTATAAGCTTCCTCATACTCGCGCATTCTTGGAAGTCTGAGACTGGAAATGCCTACCCAGATATGTTAAGTCAGTAAAGGAAAACTCATTTGCAATGCTGAGAGGAGAAAGAAAATCAATGAATAGGAGAGCATACACTGTGGGAAGGCTCAGCTGTACTGAGCCAGGCAAAGCATCCGATTACCCCACTGCTGTACACATCATGACCTGGGATAAACCCCTGGGCCGTTGGCCTAAGAAATATGTTGCTTTTCATCCTGTATAACTGCAACTTTGTGCCGGCTCATATTATGTTCTAGAGAGCTCATGTACACCATGGTGACCATAGTTAATAATACTGGATTGTATGCTTAAAATTTGCTAAGAGAGTAGATCTTAAGTCATCACCAAAAAAAGTAACTGTAAGATGATGGAGATGTGTTAATTAGCTTGACGGTGGTAATCACAATATATGTGTATATCAAAACATCACATTATACACCTTAAATGTATATAATATTTGTCAATTATACCTCAGTAAAGCCAAAAAGAAATAAATATATTGCTTTTCACCCTCTGGCAAGTGGAGGGCCCTGAACAGAGCCCTCTAAAGAACAGCTTGTCCTAATCATCACGTACCTGATGAACCTCTGTTTCCCCTGCAGCCAGCGACTCTGCGGACGATGGC