Transcript asmbl_57607

Sequence
Transcript Sequence for observation asmbl_57607 of TGE0058663:
CTGACTCTTCCTTGTCTGGAGGGAGGAGGTACTCCACCACCTTCTCAATGCTGCCCAAGGCCAAGTCGGCCCCTCCAGAAGCCAGTCGGCCAGCTCGAGTGTTGGCAGCAAATTCCGCAGTGTCTCTGGCCACCCCCCAGGCAAGCTCGCACCCGGCCAAAGCGGCCCCCAGGACCTTGTCTGAAGTGCTCGCGATGGGAACGCTGATGCTGTTTCTGGCACTGCGGAGGCGGGTGGAGATGGTGTCCTTCAGCTCAGAAGCAATCTGGGGGAAGTTGGTGGGGGTGTTAGGCATGTGGTCTTGCAGGCCCTACAAGGGCTGCCCTTCCGGGGTCTGGTGGCCTGAGCCCAGCTCCCAGGAAGGCATCACCTAAAGGCCCAGGGAACTGGTACTGATATTTAGGTACCTGGAATTAAGCTGGGCTTTAGAGGAGAGGGCTCCAACCTTCCCTGTGCCAACTGTTTGGATCTCCTGG