Transcript asmbl_54471

Sequence
Transcript Sequence for observation asmbl_54471 of TGE0056542:
ATTTGATTTGGCAGAGCTTTCAGGCACAAAGCCCTATGTTCCCTCTGGCCCAAAGCCACTACTCTGAAGGCTGAAAACTGCCCTTTGGCTCAGGTTGCTGTCCAGTCACAGCCTCACAGATAATTTGTGCTGAACCTTGAGGTGAGGGCAGAGGCCACTTCTTTAAATACTTTGTCTTCTCTACTGCCTTACATTTGAAAAGCACAGGTTGGATCAATAAGTATTAAACGTATAGCGTATTACTCCTTTGAAGCCTCCCTGCTTGACTCCTCCCTTTCCTGCCTTCTCATTCCCTACTTTATTGCATCACAGATACGTAATTTATTACCAAGGATCTTTCATAATTCCCCACCCCTGCCTCTTTCTTCTCTTGCCCACACTGTGTGACTTAACAGAGTCAACAATACATATAATTCCACCAGCAACAAAGAAAATAAGTTTTGTTTTCCTATTGTCTGTTTTCATGAAGAGGCCCTTCTTAGTTAATCTGAAAGCTATGGCTTATACCATAGTCCTCCATCATATCTAAAGCCAGGAACTAGAACTTGGGCTTGTGCTTGAGTCCTGGGTAAAGAAGGGTTGAGTGGTGCTAATTCTTGGCTGTCTGGGTGCTCTTGATTAGTGATAGAATCCTAGTCAACACTGTCGCTTATCCAGACCCAGGAGAATAAAAATCTACTTGGCTCTCCTACTCTTCATTCTGGTAGCATCTTAGGCCAGGTAAAGTTCAATAAATTTTTTTGAATTCTAAGAAGTGGGAATTCCTCCCTCAACTCAAAGGCTATATTGTCAAAAACTCAACTCCCGGCTCTGTCGCTTCTTCACTGAGGGCAATTTATCTCCATAATCAAAGATGAATACATTCAGATGAACTCTTCTGTGTGGGTTTAAATTTTACTGTTCAGCATTCAGTCTTGCTAGTAAATAAGAAAAGATGAGAGAAATGGATTGAAAACTCCCACAAGACCCTCTATGGAAAAGGAGCCAAAAGATTGCAGAGGTATATAGAACTTTAGAGCTTTTGAGTTTAATGATGTCTATCCCTATACCTTCTTTCTGGAAAGCAGATTTTTGTGAATTGAGGGCAGGAACATTACAGAACTGATGCTTCATGGCTCTGGAATACTAAGTCCTCTGAGCCTGGATCTCCTTCAGCTCTGCCACCTACCTCCTTGTTTGCTAAATGTCCTTAGAGAAGTTAGGATATGCCTGGGGAACCCTGGGTCATATAACCATGACAACTGGCTGACCCTGTTGTCTCTCCCTCTCTGCCCTCCTCTAGCTGGGAGGTGGAAGCAGCATTGCCCAAGCCTCCCAGGAGTGACAGGAATTGTTTCTGCCTGAGGAGACACTCTGCAGCCTGGGCTCTGTGAGACTGAGGTGGCGGTCAGCCGGAGTGAGTGTTGGGGTCCTGGGGCACCTGCCTTACATGGCTTGTTTATGAACATTAAAGGGAAGAAGTTGAAGCTTGAGGAGCGAGGATGGCAGTCAACAAAGGCCTCACCTTGCTGGATGGAGACCTCCCTGAGCAGGAGAATGTGCTGCAGCGGGTCCTGCAGCTGCCGGTGGTGAGTGGCACCTGCGAATGCTTCCAGAAGACCTACACCAGCACTAAGGAAGCCCACCCCCTGGTGGCCTCTGTGTGCAATGCCTATGAGAAGGGCGTGCAGAGCGCCAGTAGCTTGGCTGCCTGGAGCATGGAGCCGGTGGTCCGCAGGCTGTCCACCCAGTTCACAGCTGCCAATGAGCTGGCCTGCCGAGGCTTGGACCACCTGGAGGAAAAGATCCCCGCCCTCCAGTACCCCCCTGAAAAGATTGCTTCTGAGCTGAAGGACACCATCTCCACCCGCCTCCGCAGTGCCAGAAACAGCATCAGCGTTCCCATCGCGAGCACTTCAGACAAGGTCCTGGGGGCCGCTTTGGCCGGGTGCGAGCTTGCCTGGGGGGTGGCCAGAGACACTGCGGAATTTGCTGCCAACACTCGAGCTGGCCGACTGGCTTCTGGAGGGGCCGACTTGGCCTTGGGCAGCATTGAGAAGGTGGTGGAGTACCTCCTCCCTCCAGACAAGGAAGAGTCAGCCCCTGCTCCTGGACACCAGCAAGCCCAGAAGTCTCCCAAGGCCAAGCCAAGCCTCTTGAGCAGGGTTGGGGCTCTGACCAACACCCTCTCTCGATACACCGTGCAGACCATGGCCCGGGCCCTGGAGCAGGGCCACACCGTGGCCATGTGGATCCCAGGCGTGGTGCCCCTGAGCAGCCTGGCCCAGTGGGGTGCCTCAGTGGCCATGCAGGCGGTGTCCCGGCGGAGGAGCGAAGTGCGGGTACCCTGGCTGCACAGCCTCGCAGCCGCCCAGGAGGAGGATCATGAGGACCAGACAGACACGGAGGGAGAGGACACGGAGGAGGAGGAAGAATTGGAGACTGAGGAGAACAAGTTCAGTGAGGTAGCAGCCCTGCCAGGCCCTCGAGGCCTCCTGGGTGGTGTGGCACATACCCTGCAGAAGACCCTCCAGACCACCATCTCGGCTGTGACATGGGCACCTGCAGCTGTGCTGGGCATGGCAGGGAGGGTGCTGCACCTCACACCAGCCCCTGCTGTCTCCTCAACCAAGGGGAGGGCCATGTCCCTATCAGATGCCCTGAAGGGCGTTACTGACAACGTGGTGGACACAGTGGTGCATTACGTGCCGCTCCCCAGGCTGTCGCTGATGGAGCCCGAGAGCGAATTCCGGGACATCGACAACCCACCAGCCGAGGTCGAGCGCCGGGAGGCGGAGCGCAGAGCGTCTGGGGCGCCGTCCGCCGGCCCGGAGCCCGCCCCGCGTCTCGCACAGCCCCGCCGCAGCCTGCGCAGCGCGCAGAGCCCCGGCGCGCCCCCCGGCCCGGGCCTGGAGGACGAAGTCGCCACGCCCGCAGCGCCGCGCCCGGGCTTCCCGGCCGTGCCCCGCGAGAAGCCAAAGCGCAGGGTCAGCGACAGCTTCTTCCGGCCCAGCGTCATGGAGCCCATCCTGGGCCGCACGCATTACAGCCAGCTGCGCAAGAAGAGCTGAGTCGCCGCACCAGCCGCCGCGCCCCGGGCCGGCGGGTTTCTCTAACAAATAAACAGAACCCGCACTGCCCAGGCGAGCGTTGCCACTTTCAAAGTGGTCCCCTGGGGAGCTCAGCCTCATCCTGATGATGCTGCCAAGGCGCACTTTTTATTTTTATTTTATTTTTATTTTTTTTTTAGCATCCTTTTGGGGCTTCACTCTCAGAGCCAGTTTTTAAGGGACACCAGAGCCGCAGCCTGCTCTGATTCTATGGCTTGGTTGTTACTATAAGAGTAATTGCCTAACTTGATTTTTCATCTCTTTAACCAAACTTGTGGCCAAAAGATATTTGACCGTTTCCAAAATTCAGATTCTGCCTCTGCGGATAAATATTTGCCACGAATGAGTAACTCCTGTCACCACTCTGAAGGTCCAGACAGAAGGTTTTGACACATTCTTAGCACTGAACTCCTCTGTGATCTAGGATGATCTGTTCCCCCTCTGATGAACATCCTCTGATGATCTAGGCTCCCAGCAGGCTACTTTGAAGGGAACAATCAGATGCAAAAGCTCTTGGGTGTTTATTTAAAATACTAGTGTCACTTTCTGAGTACCCGCCGCTTCACAGGCTGAGTCCAGGCCTGTGTGCTTTGTAGAGCCAGCTGCTTGCTCACAGCCACATTTCCATTTGCATCATTACTGCCTTCACCTGCATAGTCACTCTTTTGATGCTGGGGAACCAAAATGGTGATGATATATAGACTTTATGTATAGCCACAGTTCATCCCCAACCCTAGTCTTCGAAATGTTAATATTTGATAAATCTAGAAAATGCATTCATACAATTACAGAATTCAAATATTGCAAAAGGATGTGTGTCTTTCTCCCCGAGCTCCCCTGTTCCCCTTCATTGAAAACCACCACGGTGCCATCTCTTGTGTATGCAGGGCTATGCACCTGCAGGCACGTGTGTATGCACTCCCCGCTTGTGTTTACACAAGCTGTGGGGTGTTACGCATGCCTGCTTTTTTCACTTAATAATACAGCTTGGAGAGATTTTTGTATCACATTATAAATCCCACTCGCTCTTTTTGATGGCCACATAATAACTACTGCATAATATGGATACGCCTTATTTGATTTAACTAGTTCCCTAATGATGGACTTTTAAGTTGTTTCCTTTTTTTTTCTTTTTTGCTACTGCAAACGATGCTATAATAAATGTCCTTATC