Transcript asmbl_54470

Sequence
Transcript Sequence for observation asmbl_54470 of TGE0056542:
TGACAAGTAAGCTATGGAGCAACTCATTGCTATGGGACCCTAAGGAGTGGGGCTATTGTGTGTGATATTCACCCTCCAACCTAATGCCTTCTGTTCAGGGCAAATGGGCCCCCAGGCAGCCTGGGCCTAGTTGGTGGCCATGAGAGGTAGGGAAGTGACCCAGTGGAGCTCAAGCCTGAGGGCTTCTGATGGGACCTGGGACTCTGTTTTGCAGCTTGAGGAGCGAGGATGGCAGTCAACAAAGGCCTCACCTTGCTGGATGGAGACCTCCCTGAGCAGGAGAATGTGCTGCAGCGGGTCCTGCAGCTGCCGGTGGTGAGTGGCACCTGCGAATGCTTCCAGAAGACCTACACCAGCACTAAGGAAGCCCACCCCCTGGTGGCCTCTGTGTGCAATGCCTATGAGAAGGGCGTGCAGAGCGCCAGTAGCTTGGCTGCCTGGAGCATGGAGCCGGTGGTCCGCAGGCTGTCCACCCAGTTCACAGCTGCCAATGAGCTGGCCTGCCGAGGCTTGGACCACCTGGAGGAAAAGATCCCCGCCCTCCAGTACCCCCCTGAAAAGATTGCTTCTGAGCTGAAGGACACCATCTCCACCCGCCTCCGCAGTGCCAGAAACAGCATCAGCGTTCCCATCGCGAGCACTTCAGACAAGGTCCTGGGGGCCGCTTTGGCCGGGTGCGAGCTTGCCTGGGGGGTGGCCAGAGACACTGCGGAATTTGCTGCCAACACTCGAGCTGGCCGACTGGCTTCTGGAGGGGCCGACTTGGCCTTGGGCAGCATTGAGAAGGTGGTGGAGTACCTCCTCCCTCCAGACAAGGAAGAGTCAGCCCCTGCTCCTGGACACCAGCAAGCCCAGAAGTCTCCCAAGGCCAAGCCAAGCCTCTTGAGCAGGGTTGGGGCTCTGACCAACACCCTCTCTCGATACACCGTGCAGACCATGGCCCGGGCCCTGGAGCAGGGCCACACCGTGGCCATGTGGATCCCAGGCGTGGTGCCCCTGAGCAGCCTGGCCCAGTGGGGTGCCTCAGTGGCCATGCAGGCGGTGTCCCGGCGGAGGAGCGAAGTGCGGGTACCCTGGCTGCACAGCCTCGCAGCCGCCCAGGAGGAGGATCATGAGGACCAGACAGACACGGAGGGAGAGGACACGGAGGAGGAGGAAGAATTGGAGACTGAGGAGAACAAGTTCAGTGAGGTAGCAGCCCTGCCAGGCCCTCGAGGCCTCCTGGGTGGTGTGGCACATACCCTGCAGAAGACCCTCCAGACCACCATCTCGGCTGTGACATGGGCACCTGCAGCTGTGCTGGGCATGGCAGGGAGGGTGCTGCACCTCACACCAGCCCCTGCTGTCTCCTCAACCAAGGGGAGGGCCATGTCCCTATCAGATGCCCTGAAGGGCGTTACTGACAACGTGGTGGACACAGTGGTGCATTACGTGCCGCTCCCCAGGCTGTCGCTGATGGAGCCCGAGAGCGAATTCCGGGACATCGACAACCCACCAGCCGAGGTCGAGCGCCGGGAGGCGGAGCGCAGAGCGTCTGGGGCGCCGTCCGCCGGCCCGGAGCCCGCCCCGCGTCTCGCACAGCCCCGCCGCAGCCTGCGCAGCGCGCAGAGCCCCGGCGCGCCCCCCGGCCCGGGCCTGGAGGACGAAGTCGCCACGCCCGCAGCGCCGCGCCCGGGCTTCCCGGCCGTGCCCCGCGAGAAGCCAAAGCGCAGGGTCAGCGACAGCTTCTTCCGGCCCAGCGTCATGGAGCCCATCCTGGGCCGCACGCATTACAGCCAGCTGCGCAAGAAGAGCTGAGTCGCCGCACCAGCCGCCGCGCCCCGGGCCGGCGGGTTTCTCTAACAAATAAACAGAACCCGCACTGCCCAGGCGAGCGTTGCCACTTTCAAAGTGGTCCCCTGGGGAGCTCAGCCTCATCCTGATGATGCTGCCAAGGCGCACTTTTTATTTTTATTTTATTTTTATTTTTTTTTTAGCATCCTTTTGGGGCTTCACTCTCAGAGCCAGTTTTTAAGGGACACCAGAGCCGCAGCCTGCTCTGATTCTATGGCTTGGTTGTTACTATAAGAGTAATTGCCTAACTTGATTTTTCATCTCTTTAACCAAACTTGTGGCCAAAAGATATTTGACCGTTTCCAAAATTCAGATTCTGCCTCTGCGGATAAATATTTGCCACGAATGAGTAACTCCTGTCACCACTCTGAAGGTCCAGACAGAAGGTTTTGACACATTCTTAGCACTGAACTCCTCTGTGATCTAGGATGATCTGTTCCCCCTCTGATGAACATCCTCTGATGATCTAGGCTCCCAGCAGGCTACTTTGAAGGGAACAATCAGATGCAAAAGCTCTTGGGTGTTTATTTAAAATACTAGTGTCACTTTCTGAGTACCCGCCGCTTCACAGGCTGAGTCCAGGCCTGTGTGCTTTGTAGAGCCAGCTGCTTGCTCACAGCCACATTTCCATTTGCATCATTACTGCCTTCACCTGCATAGTCACTCTTTTGATGCTGGGGAACCAAAATGGTGATGATATATAGACTTTATGTATAGCCACAGTTCATCCCCAACCCTAGTCTTCGAAATGTTAATATTTGATAAATCTAGAAAATGCATTCATACAATTACAGAATTCAAATATTGCAAAAGGATGTGTGTCTTTCTCCCCGAGCTCCCCTGTTCCCCTTCATTGAAAACCACCACGGTGCCATCTCTTGTGTATGCAGGGCTATGCACCTGCAGGCACGTGTGTATGCACTCCCCGCTTGTGTTTACACAAGCTGTGGGGTGTTACGCATGCCTGCTTTTTTCACTTAATAATACAGCTTGGAGAGATTTTTGTATCACATTATAAATCCCACTCGCTCTTTTTGATGGCCACATAATAACTACTGCATAATATGGATACGCCTTATTTGATTTAACTAGTTCCCTAATGATGGACTTTTAAGTTGTTTCCTTTTTTTTTCTTTTTTGCTACTGCAAACGATGCTATAATAAATGTCCTTATC