Transcript asmbl_54469

Sequence
Transcript Sequence for observation asmbl_54469 of TGE0056542:
CTGGGAGGTGGAAGCAGCATTGCCCAAGCCTCCCAGGAGTGACAGGAATTGTTTCTGCCTGAGGAGACACTCTGCAGCCTGGGCTCTGTGAGACTGAGGTGGCGGTCAGCCGGACTTGAGGAGCGAGGATGGCAGTCAACAAAGGCCTCACCTTGCTGGATGGAGACCTCCCTGAGCAGGAGAATGTGCTGCAGCGGGTCCTGCAGCTGCCGGTGGTGAGTGGCACCTGCGAATGCTTCCAGAAGACCTACACCAGCACTAAGGAAGCCCACCCCCTGGTGGCCTCTGTGTGCAATGCCTATGAGAAGGGCGTGCAGAGCGCCAGTAGCTTGGCTGCCTGGAGCATGGAGCCGGTGGTCCGCAGGCTGTCCACCCAGTTCACAGCTGCCAATGAGCTGGCCTGCCGAGGCTTGGACCACCTGGAGGAAAAGATCCCCGCCCTCCAGTACCCCCCTGAAAAGATTGCTTCTGAGCTGAAGGACACCATCTCCACCCGCCTCCGCAGTGCCAGAAACAGCATCAGCGTTCCCATCGCGAGCACTTCAGACAAGGTCCTGGGGGCCGCTTTGGCCGGGTGCGAGCTTGCCTGGGGGGTGGCCAGAGACACTGCGGAATTTGCTGCCAACACTCGAGCTGGCCGACTGGCTTCTGGAGGGGCCGACTTGGCCTTGGGCAGCATTGAGAAGGTGGTGGAGTACCTCCTCCCTCCAGACAAGGAAGAGTCAGCCCCTGCTCCTGGACACCAGCAAGCCCAGAAGTCTCCCAAGGCCAAGCCAAGCCTCTTGAGCAGGGTTGGGGCTCTGACCAACACCCTCTCTCGATACACCGTGCAGACCATGGCCCGGGCCCTGGAGCAGGGCCACACCGTGGCCATGTGGATCCCAGGCGTGGTGCCCCTGAGCAGCCTGGCCCAGTGGGGTGCCTCAGTGGCCATGCAGGCGGTGTCCCGGCGGAGGAGCGAAGTGCGGGTACCCTGGCTGCACAGCCTCGCAGCCGCCCAGGAGGAGGATCATGAGGACCAGACAGACACGGAGGGAGAGGACACGGAGGAGGAGGAAGAATTGGAGACTGAGGAGAACAAGTTCAGTGAGGTAGCAGCCCTGCCAGGCCCTCGAGGCCTCCTGGGTGGTGTGGCACATACCCTGCAGAAGACCCTCCAGACCACCATCTCGGCTGTGACATGGGCACCTGCAGCTGTGCTGGGCATGGCAGGGAGGGTGCTGCACCTCACACCAGCCCCTGCTGTCTCCTCAACCAAGGGGAGGGCCATGTCCCTATCAGATGCCCTGAAGGGCGTTACTGACAACGTGGTGGACACAGTGGTGCATTACGTGCCGCTCCCCAGGCTGTCGCTGATGGAGCCCGAGAGCGAATTCCGGGACATCGACAACCCACCAGCCGAGGTCGAGCGCCGGGAGGCGGAGCGCAGAGCGTCTGGGGCGCCGTCCGCCGGCCCGGAGCCCGCCCCGCGTCTCGCACAGCCCCGCCGCAGCCTGCGCAGCGCGCAGAGCCCCGGCGCGCCCCCCGGCCCGGGCCTGGAGGACGAAGTCGCCACGCCCGCAGCGCCGCGCCCGGGCTTCCCGGCCGTGCCCCGCGAGAAGCCAAAGCGCAGGGTCAGCGACAGCTTCTTCCGGCCCAGCGTCATGGAGCCCATCCTGGGCCGCACGCATTACAGCCAGCTGCGCAAGAAGAGCTGAGTCGCCGCACCAGCCGCCGCGCCCCGGGCCGGCGGGTTTCTCTAACAAATAAACAGAACCCGCACTGCCCAGGCGAGCGTTGCCACTTTCAAAGTGGTCCCCTGGGGAGCTCAGCCTCATCCTGATGATGCTGCCAAGGCGCACTTTTTATTTTTATTTTATTTTTATTTTTTTTTTAGCATCCTTTTGGGGCTTCACTCTCAGAGCCAGTTTTTAAGGGACACCAGAGCCGCAGCCTGCTCTGATTCTATGGCTTGGTTGTTACTATAAGAGTAATTGCCTAACTTGATTTTTCATCTCTTTAACCAAACTTGTGGCCAAAAGATATTTGACCGTTTCCAAAATTCAGATTCTGCCTCTGCGGATAAATATTTGCCACGAATGAGTAACTCCTGTCACCACTCTGAAGGTCCAGACAGAAGGTTTTGACACATTCTTAGCACTGAACTCCTCTGTGATCTAGGATGATCTGTTCCCCCTCTGATGAACATCCTCTGATGATCTAGGCTCCCAGCAGGCTACTTTGAAGGGAACAATCAGATGCAAAAGCTCTTGGGTGTTTATTTAAAATACTAGTGTCACTTTCTGAGTACCCGCCGCTTCACAGGCTGAGTCCAGGCCTGTGTGCTTTGTAGAGCCAGCTGCTTGCTCACAGCCACATTTCCATTTGCATCATTACTGCCTTCACCTGCATAGTCACTCTTTTGATGCTGGGGAACCAAAATGGTGATGATATATAGACTTTATGTATAGCCACAGTTCATCCCCAACCCTAGTCTTCGAAATGTTAATATTTGATAAATCTAGAAAATGCATTCATACAATTACAGAATTCAAATATTGCAAAAGGATGTGTGTCTTTCTCCCCGAGCTCCCCTGTTCCCCTTCATTGAAAACCACCACGGTGCCATCTCTTGTGTATGCAGGGCTATGCACCTGCAGGCACGTGTGTATGCACTCCCCGCTTGTGTTTACACAAGCTGTGGGGTGTTACGCATGCCTGCTTTTTTCACTTAATAATACAGCTTGGAGAGATTTTTGTATCACATTATAAATCCCACTCGCTCTTTTTGATGGCCACATAATAACTACTGCATAATATGGATACGCCTTATTTGATTTAACTAGTTCCCTAATGATGGACTTTTAAGTTGTTTCCTTTTTTTTTCTTTTTTGCTACTGCAAACGATGCTATAATAAATGTCCTTATC