Transcript asmbl_54468

Sequence
Transcript Sequence for observation asmbl_54468 of TGE0056542:
AGGAGTTCAAGGCTGCAGTGAGCTTCCACCGCACTCCAGCCCGGGTGATAGAGCAAGACCCTGTGTCTTAAAAAAAAATTAAGACAGTATTTAGACTTATCAGTTAGATTGTTTTATTTAAATCCTTCTAACAATTTAGGCAATTCTACATTAATTTTCATCAAAATTTATCCAGTCAAAAAAATTTCATGAATACTCCAGATGTAAGAGAGTCACAATTTTCTACGATAAATCAGACATCTTATTTCTAGGGTGATTGAGGGAGGTGGAAAGCGCAGGAGGAAGCCAGTGAAGAGGACAATGGAATGCTGAGTCAATGACATTGACTTGTGTTCCTATCTGCCATCTTGGGTGTGGGTCTTTATATGTGGTTACAGATCCTTTAGTTTGAGGGAGGTGAGGTAGAGAAATAGGATGCCAGCAGGTAGGAGGCCGATGTCAGTCCTCCCAGCAAAGCTGTGTCATTTATCTGAATGGAAATGAGAAAATAAATATGTACTCAATAAGTCACATTTCCCAGAAATGTGATTGAGATTCTCAAAAAATAGACTCAGATTCTTGGCTGTCTGTTTAACCAATCACGATATGGGATTTGAGAAATAAAATTTAGGGAATTTTAAGAGACATGAAAGCTACTAGGTCAGGGAAAATAAAAAGCTTAAATAACTATTTTTATTGTCCAGATCCTCTACTGTAATAGATTAACTATGTTCAATAAATTTCTAGACAAAATTGACTTGTGTCTGTGAGTGTGTTCTGGGAAGAGAGAAGAGTTAAACATAAGGCAATCCATCAGATAATCCTCAATCAGCCTACACAGTTGGTACAGCGAGCTCTGGGCTAGAAGATCCAGGCTGAGGAGGAGGATGGAGAAAGATTGAGATGTAGAGCCTCTGGGTTGAGAGGGACCTCTGAAATGAACTCATCTAGACTGCTGCCATGGAGATGGTGCTCTACAGTAGCCCTGTCAATCGCTGGCTGGCTTCTGCCTAGAGCCTCCACATTCATGAGGGATGCCAAAAATCGAAGAAGTTCTTCGTAGATGTACAGCCCAGCACATTCACAACTGAGCATTGTTGCCTGACAATTCATTTATTCAACAATGAATGTTTGAGTGCCATGCATGGTTTTGGGTATCCACTTGTGAGCAAGATGACCTAGGTCCCTGCTCTCACTTGGTGGAGGGGTAGGGAAAGCAGCTGGGAGGTGGAAGCAGCATTGCCCAAGCCTCCCAGGAGTGACAGGAATTGTTTCTGCCTGAGGAGACACTCTGCAGCCTGGGCTCTGTGAGACTGAGGTGGCGGTCAGCCGGAGTGAGTGTTGGGGTCCTGGGGCACCTGCCTTACATGGCTTGTTTATGAACATTAAAGGGAAGAAGTTGAAGCTTGAGGAGCGAGGATGGCAGTCAACAAAGGCCTCACCTTGCTGGATGGAGACCTCCCTGAGCAGGAGAATGTGCTGCAGCGGGTCCTGCAGCTGCCGGTGGTGAGTGGCACCTGCGAATGCTTCCAGAAGACCTACACCAGCACTAAGGAAGCCCACCCCCTGGTGGCCTCTGTGTGCAATGCCTATGAGAAGGGCGTGCAGAGCGCCAGTAGCTTGGCTGCCTGGAGCATGGAGCCGGTGGTCCGCAGGCTGTCCACCCAGTTCACAGCTGCCAATGAGCTGGCCTGCCGAGGCTTGGACCACCTGGAGGAAAAGATCCCCGCCCTCCAGTACCCCCCTGAAAAGATTGCTTCTGAGCTGAAGGACACCATCTCCACCCGCCTCCGCAGTGCCAGAAACAGCATCAGCGTTCCCATCGCGAGCACTTCAGACAAGGTCCTGGGGGCCGCTTTGGCCGGGTGCGAGCTTGCCTGGGGGGTGGCCAGAGACACTGCGGAATTTGCTGCCAACACTCGAGCTGGCCGACTGGCTTCTGGAGGGGCCGACTTGGCCTTGGGCAGCATTGAGAAGGTGGTGGAGTACCTCCTCCCTCCAGACAAGGAAGAGTCAGCCCCTGCTCCTGGACACCAGCAAGCCCAGAAGTCTCCCAAGGCCAAGCCAAGCCTCTTGAGCAGGGTTGGGGCTCTGACCAACACCCTCTCTCGATACACCGTGCAGACCATGGCCCGGGCCCTGGAGCAGGGCCACACCGTGGCCATGTGGATCCCAGGCGTGGTGCCCCTGAGCAGCCTGGCCCAGTGGGGTGCCTCAGTGGCCATGCAGGCGGTGTCCCGGCGGAGGAGCGAAGTGCGGGTACCCTGGCTGCACAGCCTCGCAGCCGCCCAGGAGGAGGATCATGAGGACCAGACAGACACGGAGGGAGAGGACACGGAGGAGGAGGAAGAATTGGAGACTGAGGAGAACAAGTTCAGTGAGGTAGCAGCCCTGCCAGGCCCTCGAGGCCTCCTGGGTGGTGTGGCACATACCCTGCAGAAGACCCTCCAGACCACCATCTCGGCTGTGACATGGGCACCTGCAGCTGTGCTGGGCATGGCAGGGAGGGTGCTGCACCTCACACCAGCCCCTGCTGTCTCCTCAACCAAGGGGAGGGCCATGTCCCTATCAGATGCCCTGAAGGGCGTTACTGACAACGTGGTGGACACAGTGGTGCATTACGTGCCGCTCCCCAGGCTGTCGCTGATGGAGCCCGAGAGCGAATTCCGGGACATCGACAACCCACCAGCCGAGGTCGAGCGCCGGGAGGCGGAGCGCAGAGCGTCTGGGGCGCCGTCCGCCGGCCCGGAGCCCGCCCCGCGTCTCGCACAGCCCCGCCGCAGCCTGCGCAGCGCGCAGAGCCCCGGCGCGCCCCCCGGCCCGGGCCTGGAGGACGAAGTCGCCACGCCCGCAGCGCCGCGCCCGGGCTTCCCGGCCGTGCCCCGCGAGAAGCCAAAGCGCAGGGTCAGCGACAGCTTCTTCCGGCCCAGCGTCATGGAGCCCATCCTGGGCCGCACGCATTACAGCCAGCTGCGCAAGAAGAGCTGAGTCGCCGCACCAGCCGCCGCGCCCCGGGCCGGCGGGTTTCTCTAACAAATAAACAGAACCCGCACTGCCCAGGCGAGCGTTGCCACTTTCAAAGTGGTCCCCTGGGGAGCTCAGCCTCATCCTGATGATGCTGCCAAGGCGCACTTTTTATTTTTATTTTATTTTTATTTTTTTTTTAGCATCCTTTTGGGGCTTCACTCTCAGAGCCAGTTTTTAAGGGACACCAGAGCCGCAGCCTGCTCTGATTCTATGGCTTGGTTGTTACTATAAGAGTAATTGCCTAACTTGATTTTTCATCTCTTTAACCAAACTTGTGGCCAAAAGATATTTGACCGTTTCCAAAATTCAGATTCTGCCTCTGCGGATAAATATTTGCCACGAATGAGTAACTCCTGTCACCACTCTGAAGGTCCAGACAGAAGGTTTTGACACATTCTTAGCACTGAACTCCTCTGTGATCTAGGATGATCTGTTCCCCCTCTGATGAACATCCTCTGATGATCTAGGCTCCCAGCAGGCTACTTTGAAGGGAACAATCAGATGCAAAAGCTCTTGGGTGTTTATTTAAAATACTAGTGTCACTTTCTGAGTACCCGCCGCTTCACAGGCTGAGTCCAGGCCTGTGTGCTTTGTAGAGCCAGCTGCTTGCTCACAGCCACATTTCCATTTGCATCATTACTGCCTTCACCTGCATAGTCACTCTTTTGATGCTGGGGAACCAAAATGGTGATGATATATAGACTTTATGTATAGCCACAGTTCATCCCCAACCCTAGTCTTCGAAATGTTAATATTTGATAAATCTAGAAAATGCATTCATACAATTACAGAATTCAAATATTGCAAAAGGATGTGTGTCTTTCTCCCCGAGCTCCCCTGTTCCCCTTCATTGAAAACCACCACGGTGCCATCTCTTGTGTATGCAGGGCTATGCACCTGCAGGCACGTGTGTATGCACTCCCCGCTTGTGTTTACACAAGCTGTGGGGTGTTACGCATGCCTGCTTTTTTCACTTAATAATACAGCTTGGAGAGATTTTTGTATCACATTATAAATCCCACTCGCTCTTTTTGATGGCCACATAATAACTACTGCATAATATGGATACGCCTTATTTGATTTAACTAGTTCCCTAATGATGGACTTTTAAGTTGTTTCCTTTTTTTTTCTTTTTTGCTACTGCAAACGATGCTATAATAAATGTCCTTATC