Transcript asmbl_54467

Sequence
Transcript Sequence for observation asmbl_54467 of TGE0056542:
CCACTCAGTACACATGCATGTTGCTTAGATATTTGTTAGAGCCCAAAGCTGGCAAAGAGAAGGTGGTAATGAAGCTCAAGAAACTGGAGTCCAGTGTGAGCACTGGTCGTAAATACAAAATTGACTTGTGTCTGTGAGTGTGTTCTGGGAAGAGAGAAGAGTTAAACATAAGGCAATCCATCAGATAATCCTCAATCAGCCTACACAGTTGGTACAGCGAGCTCTGGGCTAGAAGATCCAGGCTGAGGAGGAGGATGGAGAAAGATTGAGATGTAGAGCCTCTGGGTTGAGAGGGACCTCTGAAATGAACTCATCTAGACTGCTGCCATGGAGATGGTGCTCTACAGTAGCCCTGTCAATCGCTGGCTGGCTTCTGCCTAGAGCCTCCACATTCATGAGGGATGCCAAAAATCGAAGAAGTTCTTCGTAGATGTACAGCCCAGCACATTCACAACTGAGCATTGTTGCCTGACAATTCATTTATTCAACAATGAATGTTTGAGTGCCATGCATGGTTTTGGGTATCCACTTGTGAGCAAGATGACCTAGGTCCCTGCTCTCACTTGGTGGAGGGGTAGGGAAAGCAGCTGGGAGGTGGAAGCAGCATTGCCCAAGCCTCCCAGGAGTGACAGGAATTGTTTCTGCCTGAGGAGACACTCTGCAGCCTGGGCTCTGTGAGACTGAGGTGGCGGTCAGCCGGAGTGAGTGTTGGGGTCCTGGGGCACCTGCCTTACATGGCTTGTTTATGAACATTAAAGGGAAGAAGTTGAAGCTTGAGGAGCGAGGATGGCAGTCAACAAAGGCCTCACCTTGCTGGATGGAGACCTCCCTGAGCAGGAGAATGTGCTGCAGCGGGTCCTGCAGCTGCCGGTGGTGAGTGGCACCTGCGAATGCTTCCAGAAGACCTACACCAGCACTAAGGAAGCCCACCCCCTGGTGGCCTCTGTGTGCAATGCCTATGAGAAGGGCGTGCAGAGCGCCAGTAGCTTGGCTGCCTGGAGCATGGAGCCGGTGGTCCGCAGGCTGTCCACCCAGTTCACAGCTGCCAATGAGCTGGCCTGCCGAGGCTTGGACCACCTGGAGGAAAAGATCCCCGCCCTCCAGTACCCCCCTGAAAAGATTGCTTCTGAGCTGAAGGACACCATCTCCACCCGCCTCCGCAGTGCCAGAAACAGCATCAGCGTTCCCATCGCGAGCACTTCAGACAAGGTCCTGGGGGCCGCTTTGGCCGGGTGCGAGCTTGCCTGGGGGGTGGCCAGAGACACTGCGGAATTTGCTGCCAACACTCGAGCTGGCCGACTGGCTTCTGGAGGGGCCGACTTGGCCTTGGGCAGCATTGAGAAGGTGGTGGAGTACCTCCTCCCTCCAGACAAGGAAGAGTCAGCCCCTGCTCCTGGACACCAGCAAGCCCAGAAGTCTCCCAAGGCCAAGCCAAGCCTCTTGAGCAGGGTTGGGGCTCTGACCAACACCCTCTCTCGATACACCGTGCAGACCATGGCCCGGGCCCTGGAGCAGGGCCACACCGTGGCCATGTGGATCCCAGGCGTGGTGCCCCTGAGCAGCCTGGCCCAGTGGGGTGCCTCAGTGGCCATGCAGGCGGTGTCCCGGCGGAGGAGCGAAGTGCGGGTACCCTGGCTGCACAGCCTCGCAGCCGCCCAGGAGGAGGATCATGAGGACCAGACAGACACGGAGGGAGAGGACACGGAGGAGGAGGAAGAATTGGAGACTGAGGAGAACAAGTTCAGTGAGGTAGCAGCCCTGCCAGGCCCTCGAGGCCTCCTGGGTGGTGTGGCACATACCCTGCAGAAGACCCTCCAGACCACCATCTCGGCTGTGACATGGGCACCTGCAGCTGTGCTGGGCATGGCAGGGAGGGTGCTGCACCTCACACCAGCCCCTGCTGTCTCCTCAACCAAGGGGAGGGCCATGTCCCTATCAGATGCCCTGAAGGGCGTTACTGACAACGTGGTGGACACAGTGGTGCATTACGTGCCGCTCCCCAGGCTGTCGCTGATGGAGCCCGAGAGCGAATTCCGGGACATCGACAACCCACCAGCCGAGGTCGAGCGCCGGGAGGCGGAGCGCAGAGCGTCTGGGGCGCCGTCCGCCGGCCCGGAGCCCGCCCCGCGTCTCGCACAGCCCCGCCGCAGCCTGCGCAGCGCGCAGAGCCCCGGCGCGCCCCCCGGCCCGGGCCTGGAGGACGAAGTCGCCACGCCCGCAGCGCCGCGCCCGGGCTTCCCGGCCGTGCCCCGCGAGAAGCCAAAGCGCAGGGTCAGCGACAGCTTCTTCCGGCCCAGCGTCATGGAGCCCATCCTGGGCCGCACGCATTACAGCCAGCTGCGCAAGAAGAGCTGAGTCGCCGCACCAGCCGCCGCGCCCCGGGCCGGCGGGTTTCTCTAACAAATAAACAGAACCCGCACTGCCCAGGCGAGCGTTGCCACTTTCAAAGTGGTCCCCTGGGGAGCTCAGCCTCATCCTGATGATGCTGCCAAGGCGCACTTTTTATTTTTATTTTATTTTTATTTTTTTTTTAGCATCCTTTTGGGGCTTCACTCTCAGAGCCAGTTTTTAAGGGACACCAGAGCCGCAGCCTGCTCTGATTCTATGGCTTGGTTGTTACTATAAGAGTAATTGCCTAACTTGATTTTTCATCTCTTTAACCAAACTTGTGGCCAAAAGATATTTGACCGTTTCCAAAATTCAGATTCTGCCTCTGCGGATAAATATTTGCCACGAATGAGTAACTCCTGTCACCACTCTGAAGGTCCAGACAGAAGGTTTTGACACATTCTTAGCACTGAACTCCTCTGTGATCTAGGATGATCTGTTCCCCCTCTGATGAACATCCTCTGATGATCTAGGCTCCCAGCAGGCTACTTTGAAGGGAACAATCAGATGCAAAAGCTCTTGGGTGTTTATTTAAAATACTAGTGTCACTTTCTGAGTACCCGCCGCTTCACAGGCTGAGTCCAGGCCTGTGTGCTTTGTAGAGCCAGCTGCTTGCTCACAGCCACATTTCCATTTGCATCATTACTGCCTTCACCTGCATAGTCACTCTTTTGATGCTGGGGAACCAAAATGGTGATGATATATAGACTTTATGTATAGCCACAGTTCATCCCCAACCCTAGTCTTCGAAATGTTAATATTTGATAAATCTAGAAAATGCATTCATACAATTACAGAATTCAAATATTGCAAAAGGATGTGTGTCTTTCTCCCCGAGCTCCCCTGTTCCCCTTCATTGAAAACCACCACGGTGCCATCTCTTGTGTATGCAGGGCTATGCACCTGCAGGCACGTGTGTATGCACTCCCCGCTTGTGTTTACACAAGCTGTGGGGTGTTACGCATGCCTGCTTTTTTCACTTAATAATACAGCTTGGAGAGATTTTTGTATCACATTATAAATCCCACTCGCTCTTTTTGATGGCCACATAATAACTACTGCATAATATGGATACGCCTTATTTGATTTAACTAGTTCCCTAATGATGGACTTTTAAGTTGTTTCCTTTTTTTTTCTTTTTTGCTACTGCAAACGATGCTATAATAAATGTCCTTATC