Transcript asmbl_54466

Sequence
Transcript Sequence for observation asmbl_54466 of TGE0056542:
CTGTGAGTGTGTTCTGGGAAGAGAGAAGAGTTAAACATAAGGCAATCCATCAGATAATCCTCAATCAGCCTACACAGTTGGTACAGCGAGCTCTGGGCTAGAAGATCCAGGCTGAGGAGGAGGATGGAGAAAGATTGAGATGTAGAGCCTCTGGGTTGAGAGGGACCTCTGAAATGAACTCATCTAGACTGCTGCCATGGAGATGGTGCTCTACAGTAGCCCTGTCAATCGCTGGCTGGCTTCTGCCTAGCTGGGAGGTGGAAGCAGCATTGCCCAAGCCTCCCAGGAGTGACAGGAATTGTTTCTGCCTGAGGAGACACTCTGCAGCCTGGGCTCTGTGAGACTGAGGTGGCGGTCAGCCGGAGTGAGTGTTGGGGTCCTGGGGCACCTGCCTTACATGGCTTGTTTATGAACATTAAAGGGAAGAAGTTGAAGCTTGAGGAGCGAGGATGGCAGTCAACAAAGGCCTCACCTTGCTGGATGGAGACCTCCCTGAGCAGGAGAATGTGCTGCAGCGGGTCCTGCAGCTGCCGGTGGTGAGTGGCACCTGCGAATGCTTCCAGAAGACCTACACCAGCACTAAGGAAGCCCACCCCCTGGTGGCCTCTGTGTGCAATGCCTATGAGAAGGGCGTGCAGAGCGCCAGTAGCTTGGCTGCCTGGAGCATGGAGCCGGTGGTCCGCAGGCTGTCCACCCAGTTCACAGCTGCCAATGAGCTGGCCTGCCGAGGCTTGGACCACCTGGAGGAAAAGATCCCCGCCCTCCAGTACCCCCCTGAAAAGATTGCTTCTGAGCTGAAGGACACCATCTCCACCCGCCTCCGCAGTGCCAGAAACAGCATCAGCGTTCCCATCGCGAGCACTTCAGACAAGGTCCTGGGGGCCGCTTTGGCCGGGTGCGAGCTTGCCTGGGGGGTGGCCAGAGACACTGCGGAATTTGCTGCCAACACTCGAGCTGGCCGACTGGCTTCTGGAGGGGCCGACTTGGCCTTGGGCAGCATTGAGAAGGTGGTGGAGTACCTCCTCCCTCCAGACAAGGAAGAGTCAGCCCCTGCTCCTGGACACCAGCAAGCCCAGAAGTCTCCCAAGGCCAAGCCAAGCCTCTTGAGCAGGGTTGGGGCTCTGACCAACACCCTCTCTCGATACACCGTGCAGACCATGGCCCGGGCCCTGGAGCAGGGCCACACCGTGGCCATGTGGATCCCAGGCGTGGTGCCCCTGAGCAGCCTGGCCCAGTGGGGTGCCTCAGTGGCCATGCAGGCGGTGTCCCGGCGGAGGAGCGAAGTGCGGGTACCCTGGCTGCACAGCCTCGCAGCCGCCCAGGAGGAGGATCATGAGGACCAGACAGACACGGAGGGAGAGGACACGGAGGAGGAGGAAGAATTGGAGACTGAGGAGAACAAGTTCAGTGAGGTAGCAGCCCTGCCAGGCCCTCGAGGCCTCCTGGGTGGTGTGGCACATACCCTGCAGAAGACCCTCCAGACCACCATCTCGGCTGTGACATGGGCACCTGCAGCTGTGCTGGGCATGGCAGGGAGGGTGCTGCACCTCACACCAGCCCCTGCTGTCTCCTCAACCAAGGGGAGGGCCATGTCCCTATCAGATGCCCTGAAGGGCGTTACTGACAACGTGGTGGACACAGTGGTGCATTACGTGCCGCTCCCCAGGCTGTCGCTGATGGAGCCCGAGAGCGAATTCCGGGACATCGACAACCCACCAGCCGAGGTCGAGCGCCGGGAGGCGGAGCGCAGAGCGTCTGGGGCGCCGTCCGCCGGCCCGGAGCCCGCCCCGCGTCTCGCACAGCCCCGCCGCAGCCTGCGCAGCGCGCAGAGCCCCGGCGCGCCCCCCGGCCCGGGCCTGGAGGACGAAGTCGCCACGCCCGCAGCGCCGCGCCCGGGCTTCCCGGCCGTGCCCCGCGAGAAGCCAAAGCGCAGGGTCAGCGACAGCTTCTTCCGGCCCAGCGTCATGGAGCCCATCCTGGGCCGCACGCATTACAGCCAGCTGCGCAAGAAGAGCTGAGTCGCCGCACCAGCCGCCGCGCCCCGGGCCGGCGGGTTTCTCTAACAAATAAACAGAACCCGCACTGCCCAGGCGAGCGTTGCCACTTTCAAAGTGGTCCCCTGGGGAGCTCAGCCTCATCCTGATGATGCTGCCAAGGCGCACTTTTTATTTTTATTTTATTTTTATTTTTTTTTTAGCATCCTTTTGGGGCTTCACTCTCAGAGCCAGTTTTTAAGGGACACCAGAGCCGCAGCCTGCTCTGATTCTATGGCTTGGTTGTTACTATAAGAGTAATTGCCTAACTTGATTTTTCATCTCTTTAACCAAACTTGTGGCCAAAAGATATTTGACCGTTTCCAAAATTCAGATTCTGCCTCTGCGGATAAATATTTGCCACGAATGAGTAACTCCTGTCACCACTCTGAAGGTCCAGACAGAAGGTTTTGACACATTCTTAGCACTGAACTCCTCTGTGATCTAGGATGATCTGTTCCCCCTCTGATGAACATCCTCTGATGATCTAGGCTCCCAGCAGGCTACTTTGAAGGGAACAATCAGATGCAAAAGCTCTTGGGTGTTTATTTAAAATACTAGTGTCACTTTCTGAGTACCCGCCGCTTCACAGGCTGAGTCCAGGCCTGTGTGCTTTGTAGAGCCAGCTGCTTGCTCACAGCCACATTTCCATTTGCATCATTACTGCCTTCACCTGCATAGTCACTCTTTTGATGCTGGGGAACCAAAATGGTGATGATATATAGACTTTATGTATAGCCACAGTTCATCCCCAACCCTAGTCTTCGAAATGTTAATATTTGATAAATCTAGAAAATGCATTCATACAATTACAGAATTCAAATATTGCAAAAGGATGTGTGTCTTTCTCCCCGAGCTCCCCTGTTCCCCTTCATTGAAAACCACCACGGTGCCATCTCTTGTGTATGCAGGGCTATGCACCTGCAGGCACGTGTGTATGCACTCCCCGCTTGTGTTTACACAAGCTGTGGGGTGTTACGCATGCCTGCTTTTTTCACTTAATAATACAGCTTGGAGAGATTTTTGTATCACATTATAAATCCCACTCGCTCTTTTTGATGGCCACATAATAACTACTGCATAATATGGATACGCCTTATTTGATTTAACTAGTTCCCTAATGATGGACTTTTAAGTTGTTTCCTTTTTTTTTCTTTTTTGCTACTGCAAACGATGCTATAATAAATGTCCTTATC