Transcript asmbl_54465

Sequence
Transcript Sequence for observation asmbl_54465 of TGE0056234:
AGGAGTTCAAGGCTGCAGTGAGCTTCCACCGCACTCCAGCCCGGGTGATAGAGCAAGACCCTGTGTCTTAAAAAAAAATTAAGACAGTATTTAGACTTATCAGTTAGATTGTTTTATTTAAATCCTTCTAACAATTTAGGCAATTCTACATTAATTTTCATCAAAATTTATCCAGTCAAAAAAATTTCATGAATACTCCAGATGTAAGAGAGTCACAATTTTCTACGATAAATCAGACATCTTATTTCTAGGGTGATTGAGGGAGGTGGAAAGCGCAGGAGGAAGCCAGTGAAGAGGACAATGGAATGCTGAGTCAATGACATTGACTTGTGTTCCTATCTGCCATCTTGGGTGTGGGTCTTTATATGTGGTTACAGATCCTTTAGTTTGAGGGAGGTGAGGTAGAGAAATAGGATGCCAGCAGGTAGGAGGCCGATGTCAGTCCTCCCAGCAAAGCTGTGTCATTTATCTGAATGGAAATGAGAAAATAAATATGTACTCAATAAGTCACATTTCCCAGAAATGTGATTGAGATTCTCAAAAAATAGACTCAGATTCTTGGCTGTCTGTTTAACCAATCACGATATGGGATTTGAGAAATAAAATTTAGGGAATTTTAAGAGACATGAAAGCTACTAGGTCAGGGAAAATAAAAAGCTTAAATAACTATTTTTATTGTCCAGATCCTCTACTGTAATAGATTAACTATGTTCAATAAATTTCTAGACAAAATTGACTTGTGTCTGTGAGTGTGTTCTGGGAAGAGAGAAGAGTTAAACATAAGGCAATCCATCAGATAATCCTCAATCAGCCTACACAGTTGGTACAGCGAGCTCTGGGCTAGAAGATCCAGGCTGAGGAGGAGGATGGAGAAAGATTGAGATGTAGAGCCTCTGGGTTGAGAGGGACCTCTGAAATGAACTCATCTAGACTGCTGCCATGGAGATGGTGCTCTACAGTAGCCCTGTCAATCGCTGGCTGGCTTCTGCCTAGAGCCTCCACATTCATGAGGGATGCCAAAAATCGAAGAAGTTCTTCGTAGATGTACAGCCCAGCACATTCACAACTGAGCATTGTTGCCTGACAATTCATTTATTCAACAATGAATGTTTGAGTGCCATGCATGGTTTTGGGTATCCACTTGTGAGCAAGATGACCTAGGTCCCTGCTCTCACTTGGTGGAGGGGTAGGGAAAGCAGCTGGGAGGTGGAAGCAGCATTGCCCAAGCCTCCCAGGAGTGACAGGAATTGTTTCTGCCTGAGGAGACACTCTGCAGCCTGGGCTCTGTGAGACTGAGGTGGCGGTCAGCCGGAGTGAGTGTTGGGGTCCTGGGGCACCTGCCTTACATGGCTTGTTTATGAACATTAAAGGGAAGAAGTTGAAGCTTGAGGAGCGAGGATGGCAGTCAACAAAGGCCTCACCTTGCTGGATGGAGACCTCCCTGAGCAGGAGAATGTGCTGCAGCGGGTCCTGCAGCTGCCGGTGGTGAGTGGCACCTGCGAATGCTTCCAGAAGACCTACACCAGCACTAAGGAAGCCCACCCCCTGGTGGCCTCTGTGTGCAATGCCTATGAGAAGGGCGTGCAGAGCGCCAGTAGCTTGGCTGCCTGGAGCATGGAGCCGGTGGTCCGCAGGCTGTCCACCCAGTTCACAGCTGCCAATGAGCTGGCCTGCCGAGGCTTGGACCACCTGGAGGAAAAGATCCCCGCCCTCCAGTACCCCCCTGAAAAGATTGCTTCTGAGCTGAAGGACACCATCTCCACCCGCCTCCGCAGTGCCAGAAACAGCATCAGCGTTCCCATCGCGAGCACTTCAGACAAGGTCCTGGGGGCCGCTTTGGCCGGGTGCGAGCTTGCCTGGGGGGTGGCCAGAGACACTGCGGAATTTGCTGCCAACACTCGAGCTGGCCGACTGGCTTCTGGAGGGGCCGACTTGGCCTTGGGCAGCATTGAGAAGGTGGTGGAGTACCTCCTCCCTCCAGACAAGGAAGAGTCAGGTACCTGCCATTCGGAGGCTCGGCCTGGGAGTGAGTTGTCACACACACTGCCTGGGAATCAGCAGGAGGTGGCTCAACCAGCCACTGCTCTGGAATAGGGAAGGCCAGTGGGATTTTCAGATGGATTCATAATCATTTACCCCCCCCACCCCCACCCCATCTGTAAAGAGGGAAAGTGAGTTGTGGAACTCACCAGTGAGTTTGTGGTGGACCTAGAACACCTACTTTCCAGTCCTAGACATGACCCAGATCTCTCCGGCCCCTCTCTGACCTGTTTTCTCTTCTTTCCCCCCAAATCCCTACCCAGCCCCTGCTCCTGGACACCAGCAAGCCCAGAAGTCTCCCAAGGCCAAGCCAAGCCTCTTGAGCAGGGTTGGGGCTCTGACCAACACCCTCTCTCGATACACCGTGCAGACCATGGCCCGGGCCCTGGAGCAGGGCCACACCGTGGCCATGTGGATCCCAGGCGTGGTGCCCCTGAGCAGCCTGGCCCAGTGGGGTGCCTCAGTGGCCATGCAGGCGGTGTCCCGGCGGAGGAGCGAAGTGCGGGTACCCTGGCTGCACAGCCTCGCAGCCGCCCAGGAGGAGGATCATGAGGACCAGACAGACACGGAGGGAGAGGACACGGAGGAGG