Transcript asmbl_54464

Sequence
Transcript Sequence for observation asmbl_54464 of TGE0058662:
AGGAGTTCAAGGCTGCAGTGAGCTTCCACCGCACTCCAGCCCGGGTGATAGAGCAAGACCCTGTGTCTTAAAAAAAAATTAAGACAGTATTTAGACTTATCAGTTAGATTGTTTTATTTAAATCCTTCTAACAATTTAGGCAATTCTACATTAATTTTCATCAAAATTTATCCAGTCAAAAAAATTTCATGAATACTCCAGATGTAAGAGAGTCACAATTTTCTACGATAAATCAGACATCTTATTTCTAGGGTGATTGAGGGAGGTGGAAAGCGCAGGAGGAAGCCAGTGAAGAGGACAATGGAATGCTGAGTCAATGACATTGACTTGTGTTCCTATCTGCCATCTTGGGTGTGGGTCTTTATATGTGGTTACAGATCCTTTAGTTTGAGGGAGGTGAGGTAGAGAAATAGGATGCCAGCAGGTAGGAGGCCGATGTCAGTCCTCCCAGCAAAGCTGTGTCATTTATCTGAATGGAAATGAGAAAATAAATATGTACTCAATAAGTCACATTTCCCAGAAATGTGATTGAGATTCTCAAAAAATAGACTCAGATTCTTGGCTGTCTGTTTAACCAATCACGATATGGGATTTGAGAAATAAAATTTAGGGAATTTTAAGAGACATGAAAGCTACTAGGTCAGGGAAAATAAAAAGCTTAAATAACTATTTTTATTGTCCAGATCCTCTACTGTAATAGATTAACTATGTTCAATAAATTTCTAGACAAAATTGACTTGTGTCTGTGAGTGTGTTCTGGGAAGAGAGAAGAGTTAAACATAAGGCAATCCATCAGATAATCCTCAATCAGCCTACACAGTTGGTACAGCGAGCTCTGGGCTAGAAGATCCAGGCTGAGGAGGAGGATGGAGAAAGATTGAGATGTAGAGCCTCTGGGTTGAGAGGGACCTCTGAAATGAACTCATCTAGACTGCTGCCATGGAGATGGTGCTCTACAGTAGCCCTGTCAATCGCTGGCTGGCTTCTGCCTAGAGCCTCCACATTCATGAGGGATGCCAAAAATCGAAGAAGTTCTTCGTAGATGTACAGCCCAGCACATTCACAACTGAGCATTGTTGCCTGACAATTCATTTATTCAACAATGAATGTTTGAGTGCCATGCATGGTTTTGGGTATCCACTTGTGAGCAAGATGACCTAGGTCCCTGCTCTCACTTGGTGGAGGGGTAGGGAAAGCAGCTGGGAGGTGGAAGCAGCATTGCCCAAGCCTCCCAGGAGTGACAGGAATTGTTTCTGCCTGAGGAGACACTCTGCAGCCTGGGCTCTGTGAGACTGAGGTGGCGGTCAGCCGGAGTGAGTGTTGGGGTCCTGGGGCACCTGCCTTACATGGCTTGTTTATGAACATTAAAGGGAAGAAGTTGAAGCTTGAGGAGCGAGGATGGCAGTCAACAAAGGCCTCACCTTGCTGGATGGAGACCTCCCTGAGCAGGAGAATGTGCTGCAGCGGGTCCTGCAGCTGCCGGTGGTGAGTGGCACCTGCGAATGCTTCCAGAAGACCTACACCAGCACTAAGGAAGCCCACCCCCTGGTGGCCTCTGTGTGCAATGCCTATGAGAAGGGCGTGCAGAGCGCCAGTAGCTTGGCTGCCTGGAGCATGGAGCCGGTGGTCCGCAGGCTGTCCACCCAGTTCACAGCTGCCAATGAGCTGGCCTGCCGAGGCTTGGACCACCTGGAGGAAAAGATCCCCGCCCTCCAGTACCCCCCTGAAAAGGTGAGCCCTTCCCACCTCTCGAAGCCTCCCTGCACTCTGTCGTCACCGCCTCTCAGGGAGGAGAGGGCAGGGGCTGCTGATGCCGTGACTGGAAGTCTGTGTCCCATGATTGCTTCTGAGCTGAAGGACACCATCTCCACCCGCCTCCGCAGTGCCAGAAACAGCATCAGCGTTCCCATCGCGAGCACTTCAGACAAGGTCCTGGGGGCCGCTTTGGCCGGGTGCGAGCTTGCCTGGGGGGTGGCCAGAGACACTGCGGAATTTGCTGCCAACACTCGAGCTGGCCGACTGGCTTCTGGAGGGGCCGACTTGGCCTTGGGCAGCATTGAGAAGGTGGTGGAGTACCTCCTCCCTCCAGACAAGGAAGAGTCAG