Transcript asmbl_54117

Sequence
Transcript Sequence for observation asmbl_54117 of TGE0056228:
ATTTGGGGACGCTCTCAGCTCTCGGCGCACGGCCCAGGTTATCTTGTAGCATAGCAACTTCGGATTTCACTCTACCCGGAGAGTTTCCCGCTTGGTTGAACACATTGGCCTCAGGAAGCTTCCTTCAAAATGTCTACTGTTCACGAAATCCTGTGCAAGCTCAGCTTGGAGGGTGATCACTCTACACCCCCAAGTGCATATGGGTCTGTCAAAGCCTATACTAACTTTGATGCTGAGCGGGATGCTTTGAACATTGAAACAGCCATCAAGACCAAAGGTGTGGATGAGGTCACCATTGTCAACATTTTGACCAACCGCAGCAATGCACAGAGACAGGATATTGCCTTCGCCTACCAGAGAAGGACCAAAAAGGAACTTGCATCAGCACTGAAGTCAGCCTTATCTGGCCACCTGGAGACGGTGATTTTGGGCCTATTGAAGACACCTGCTCAGTATGACGCTTCTGAGCTAAAAGCTTCCATGAAGGGGCTGGGAACCGACGAGGACTCTCTCATTGAGATCATCTGCTCCAGAACCAACCAGGAGCTGCAGGAAATTAACAGAGTCTACAAGGAAATGTACAAGACTGATCTGGAGAAGGACATTATTTCGGACACATCTGGTGACTTCCGCAAGCTGATGGTTGCCCTGGCAAAGGGTAGAAGAGCAGAGGATGGCTCTGTCATTGATTATGAACTGATTGACCAAGATGCTCGGGATCTCTATGACGCTGGAGTGAAGAGGAAAGGAACTGATGTTCCCAAGTGGATCAGCATCATGACCGAGCGGAGCGTGCCCCACCTCCAGAAAGTATTTGATAGGTACAAGAGTTACAGCCCTTATGACATGTTGGAAAGCATCAGGAAAGAGGTTAAAGGAGACCTGGAAAATGCTTTCCTGAACCTGGTTCAGTGCATTCAGAACAAGCCCCTGTATTTTGCTGATCGGCTGTATGACTCCATGAAGGGCAAGGGGACGCGAGATAAGGTCCTGATCAGAATCATGGTCTCCCGCAGTGAAGTGGACATGTTGAAAATTAGGTCTGAATTCAAGAGAAAGTACGGCAAGTCCCTGTACTATTATATCCAGCAAGACACTAAGGGCGACTACCAGAAAGCGCTGCTGTACCTGTGTGGTGGAGATGACTGAAGCCCGACACGGCCTGAGCGTCCAGAAATGGTGCTCACCATGCTTCCAGCTAACAGGTCTAGAAAACCAGCTTGCGAATAACAGTCCCCGTGGCCATCCCTGTGAGGGTGACGTTAGCATTACCCCCAACCTCATTTTAGTTGCCTAAGCATTGCCTGGCCTTCCTGTCTAGTCTCTCCTGTAAGCCAAAGAAATGAACATTCCAAGGAGTTGGAAGTGAAGTCTATGATGTGAAACACTTTGCCTCCTGTGTACTGTGTCATAAACAGATGAATAAACTGAATTTGTACTTTAGAAACACGTACTTTGTGGCCCTGCTTTCAACTGAATTGTTTGAAAATTAAACGTGCTTGGGGTTCAGCTGGTGAGGCTGTCCCTGTAGGAAGAAAGCTCTGGGACTGAGCTGTACAGTATGGTTGCCCCTATCCAAGTGTCGCTATTTAAGTTAAATTTAAATGAAATAAAATAAAATAAAAT