Transcript asmbl_53976

Sequence
Transcript Sequence for observation asmbl_53976 of TGE0056538:
CTGGGGTGAGGGGCTGTCCCGGAACGTCCACAGCTGGCGCTGGCCCTCCCCTGCCTGACAGCTTCCTGGCCCGGGGCTCTTGGTGCCGGGCTCCGCGTCAGATGTTCGGGGGGCGGTGGCATCGCCCGGAGTCGGCGGGGACGGCGCGGCTGGCTTCCAGCCTGGCGGAGAGGGCAGGCTGAGGAGTGGGGCGTTCAGAGCGCGCATCGCGCGCAATTCGTGCCGCTAAAAAAAATAAACCCAGAGAGCTCGCCCGGGGCTTAGGACCGCTGGGGATATGGGTACTTTGCGCCGCGCTCTTCTGGCGGGGCCCGGGAGGCCGAGGGATCGGCCGGGGCTGCTGCCGCCGGGGGCCTGGGCTTTCCAGCCAGCTGTGGACCAAACGGTCTTCCCTTACCCAAATTAACTGCGCCACGCGCAGGCGGCGCACGGGTTGGGCTTGGGAATGGGGACCGCGAGGCTTCAGCATCCCGATGCCCTGAAAGTCTCCCCGCCTCGGGGATTTGTCTCTGTGTTGCAGCTGGCAGGGGCCGCCTGAAGTGGGAGCAGCGCCTGGAGAAGGCGGGAGGAGCCCGGCCCGGGGGACGGGCGGCGGGATAGCGGGACCCCGGCGGCGCGGTGCGCTTCAGGGCGCAGCGGCGGCCGCAGACCGAGCCCCGGGCGCGGCAAGAGGCGGCGGGAGCCGGTGGCGGCTCGGCATCATGCGTCGAGGGCGTCTGCTGGAGATCGCCCTGGGATTTACCGTGCTTTTAGCGTCCTACACGAGCCATGGGGCGGACGCCAATTTGGAGGCTGGGAACGTGAAGGAAACCAGAGCCAGTCGGGCCAAGAGAAGAGGCGGTGGAGGACACGACGCGCTTAAAGGACCCAATGTCTGTGGATCACGTTATAATGCTTACTGTTGCCCTGGATGGAAAACCTTACCTGGCGGAAATCAGTGTATTGTCCCCATTTGCCGGCATTCCTGTGGGGATGGATTTTGTTCGAGGCCAAATATGTGCACTTGCCCATCTGGTCAGATAGCTCCTTCCTGTGGCTCCAGATCCATACAACACTGCAATATTCGCTGTATGAATGGAGGTAGCTGCAGTGACGATCACTGTCTATGCCAGAAAGGATACATAGGGACTCACTGTGGACAACCTGTTTGTGAAAGTGGCTGTCTCAATGGAGGAAGGTGTGTGGCCCCAAATCGATGTGCATGCACTTACGGATTTACTGGACCCCAGTGTGAAAGAGATTACAGGACAGGCCCATGTTTTACTGTGATCAGCAACCAGATGTGCCAGGGACAACTCAGCGGGATTGTCTGCACAAAAACGCTCTGCTGTGCCACAGTCGGCCGAGCCTGGGGCCACCCCTGTGAGATGTGTCCTGCCCAGCCTCACCCCTGCCGCCGTGGCTTCATTCCAAATATCCGCACGGGAGCTTGTCAAGATGTGGATGAATGCCAGGCCATCCCCGGGCTCTGTCAGGGAGGAAATTGCATTAATACTGTTGGGTCTTTTGAGTGCAAATGCCCTGCTGGACACAAACTTAATGAAGTGTCACAAAAATGTGAAGATATTGATGAATGCAGCACCATTCCTGGAATCTGTGAAGGGGGTGAATGTACAAACACAGTCAGCAGTTACTTTTGCAAATGTCCCCCTGGTTTTTACACCTCTCCAGATGGTACCAGATGCATAGATGTTCGCCCAGGATACTGTTACACAGCTCTGACAAACGGGCGCTGCTCTAACCAGCTGCCACAGTCCATAACCAAAATGCAGTGCTGCTGTGATGCCGGCCGATGCTGGTCTCCAGGGGTCACTGTCGCCCCTGAGATGTGTCCCATCAGAGCAACCGAGGATTTCAACAAGCTGTGCTCTGTTCCTATGGTAATTCCTGGGAGACCAGAATATCCTCCCCCACCCCTTGGCCCCATTCCTCCAGTTCTCCCTGTTCCTCCTGGCTTTCCTCCTGGACCTCAAATTCCGGTCCCTCGACCACCAGTGGAATATCTGTATCCATCTCGGGAGCCACCAAGGGTGCTGCCAGTAAACGTTACTGATTACTGCCAGTTGGTCCGCTATCTCTGTCAAAATGGACGCTGCATTCCAACTCCTGGGAGTTACCGGTGTGAGTGCAACAAAGGGTTCCAGCTGGACCTCCGTGGGGAGTGTATTGATGTTGATGAATGTGAGAAAAACCCCTGTGCTGGTGGTGAGTGTATTAACAACCAGGGTTCGTACACCTGTCAGTGCCGAGCTGGATATCAGAGCACACTCACGCGGACAGAATGCCGAGACATTGATGAGTGTTTACAGAATGGCCGGATCTGCAATAATGGACGCTGCATCAACACAGATGGCAGTTTTCATTGCGTGTGTAATGCGGGCTTTCATGTTACACGAGATGGGAAGAACTGTGAAGATATGGATGAATGCAGCATAAGGAACATGTGCCTTAATGGAATGTGTATCAATGAAGATGGCAGTTTTAAATGTATTTGCAAACCTGGATTCCAGCTGGCATCAGATGGACGTTATTGCAAAGACATTAACGAGTGTGAAACCCCTGGGATCTGCATGAATGGGCGTTGCGTCAACACTGATGGCTCCTACAGATGTGAATGCTTCCCTGGACTGGCTGTGGGTCTGGATGGCCGTGTGTGTGTTGACACACACATGCGGAGCACATGCTATGGTGGATACAAGAGAGGCCAGTGTATCAAACCTTTGTTTGGTGCTGTCACTAAATCTGAATGCTGTTGCGCCAGCACTGAGTATGCATTTGGGGAACCTTGCCAGCCGTGTCCTGCACAGAATTCAGCGGAATATCAGGCACTCTGCAGCAGTGGGCCAGGAATGACGTCAGCAGGCAGTGATATAAATGAATGTGCACTAGATCCTGATATTTGCCCAAATGGAATCTGTGAAAACCTTCGTGGGACCTATAAATGTATATGCAATTCAGGATATGAAGTGGATTCAACTGGGAAAAACTGCGTTGATATTAATGAATGTGTACTGAACAGTCTCCTTTGTGACAATGGACAATGTAGAAATACTCCTGGAAGTTTTGTCTGTACCTGCCCCAAGGGATTTATCTACAAACCTGATCTAAAAACATGTGAAGACATTGATGAATGCGAATCAAGTCCTTGCATTAATGGAGTCTGCAAGAACAGCCCAGGCTCTTTTATTTGTGAATGTTCTTCTGAAAGTACTTTGGATCCAACAAAAACCATCTGCATAGAAACCATCAAGGGCACTTGCTGGCAGACTGTCATTGATGGGCGATGTGAGATCAACATCAATGGAGCCACCTTAAAGTCCCAGTGCTGCTCCTCCCTCGGTGCTGCGTGGGGAAGCCCGTGCACCCTATGCCAAGTTGATCCCATATGTGGTAAAGGGTACTCAAGAATTAAAGGAACACAATGTGAAGATATAGATGAATGTGAAGTGTTCCCAGGAGTGTGTAAAAATGGCCTGTGTGTTAACACTAGGGGGTCATTCAAGTGTCAGTGTCCCAGTGGAATGACTTTGGATGCCACAGGAAGGATCTGTCTTGATATCCGCCTGGAAACCTGCTTCCTGAGGTACGAGGACGAGGAGTGCACCCTGCCTATTGCTGGCCGCCACCGCATGGACGCCTGCTGCTGCTCCGTCGGGGCAGCCTGGGGTACTGAGGAATGCGAGGAGTGTCCCATGAGAAATACTCCTGAGTACGAGGAGCTGTGTCCGAGAGGACCCGGATTTGCCACAAAAGAAATTACAAATGGAAAGCCTTTCTTCAAAGATATCAATGAGTGCAAGATGATACCCAGCCTCTGCACCCACGGCAAGTGCAGAAACACCATTGGCAGCTTTAAGTGCAGGTGTGACAGCGGCTTTGCTCTTGATTCTGAAGAAAGGAACTGCACAGACATTGACGAATGCCGCATATCTCCTGACCTCTGTGGCAGAGGCCAGTGTGTGAACACCCCTGGGGACTTTGAATGCAAGTGTGACGAAGGCTATGAAAGTGGATTCATGATGATGAAGAACTGCATGGATATTGATGAGTGTCAGAGAGATCCTCTCCTATGCCGAGGTGGTGTTTGCCATAACACAGAGGGAAGTTACCGCTGTGAATGCCCGCCTGGCCATCAGCTGTCCCCCAACATCTCCGCGTGTATCGACATCAATGAATGTGAGCTGAGTGCACACCTGTGCCCCAATGGCCGTTGCGTGAACCTCATAGGGAAGTATCAGTGTGCCTGCAACCCTGGCTACCATTCAACTCCCGATAGGCTATTTTGTGTTGACATTGATGAATGCAGCATAATGAATGGTGGTTGTGAAACCTTCTGCACAAACTCTGAAGGCAGCTATGAATGTAGCTGTCAGCCGGGATTTGCACTAATGCCTGACCAGAGATCATGCACCGACATCGATGAGTGTGAAGATAATCCCAATATCTGTGATGGTGGTCAGTGCACAAATATCCCTGGAGAGTACAGGTGCTTGTGTTATGATGGATTCATGGCATCTGAAGACATGAAGACTTGTGTAGATGTCAATGAGTGTGACCTGAATCCAAATATCTGCCTAAGTGGGACCTGTGAAAACACGAAAGGCTCATTTATCTGCCACTGTGATATGGGCTACTCCGGCAAAAAAGGAAAAACTGGCTGTACAGACATCAATGAATGTGAAATTGGAGCACACAACTGTGGCAAACATGCTGTATGTACCAATACAGCAGGAAGCTTCAAATGTAGCTGCAGTCCCGGGTGGATTGGAGATGGCATTAAGTGCACTGATCTGGACGAATGTTCCAATGGAACCCATATGTGCAGCCAGCATGCAGACTGCAAGAATACCATGGGATCTTACCGCTGTCTGTGCAAGGAAGGATACACAGGTGATGGCTTCACTTGTACAGACCTTGATGAGTGCTCTGAGAACCTGAATCTCTGTGGCAATGGCCAGTGCCTCAATGCACCAGGAGGATACCGCTGTGAATGCGACATGGGCTTCGTGCCCAGTGCTGACGGGAAAGCCTGTGAAGATATTGATGAGTGCTCCCTTCCGAACATCTGTGTCTTTGGAACTTGCCACAACCTCCCTGGCCTGTTCCGCTGTGAGTGTGAGATAGGCTACGAACTGGACAGAAGCGGCGGGAACTGCACAGATGTGAATGAATGCCTGGATCCAACCACGTGCATCAGTGGGAACTGTGTCAACACTCCAGGCAGCTATATCTGTGACTGCCCACCTGATTTTGAACTGAACCCAACTCGAGTTGGCTGTGTTGATACCCGCTCTGGAAATTGCTATTTGGATATTCGACCTCGAGGAGACAATGGAGATACAGCCTGCAGCAATGAAATTGGAGTTGGTGTTTCCAAAGCTTCCTGCTGCTGTTCTCTGGGTAAAGCCTGGGGTACTCCTTGTGAGATGTGTCCTGCTGTGAACACATCCGAGTACAAAATTCTTTGTCCTGGAGGGGAAGGTTTCCGACCAAATCCTATCACCGTTATATTGGAAGATATTGATGAGTGCCAGGAGCTACCAGGGCTGTGCCAAGGAGGAAAATGTATCAACACCTTTGGGAGTTTCCAGTGCCGCTGTCCAACCGGCTACTACCTGAATGAAGATACACGAGTGTGTGATGATGTGAATGAATGTGAGACTCCTGGAATCTGTGGTCCAGGGACATGTTACAACACCGTTGGCAACTACACCTGTATCTGTCCTCCAGACTACATGCAAGTGAATGGGGGAAATAATTGCATGGATATGAGAAGAAGTTTGTGCTACAGAAACTACTATGCTGACAACCAGACCTGTGATGGAGAATTGTTATTCAACATGACCAAGAAGATGTGCTGCTGTTCCTACAACATTGGCCGGGCGTGGAACAAGCCCTGTGAACAGTGTCCCATCCCAAGTACAGATGAGTTTGCTACACTCTGTGGAAGTCAAAGGCCAGGCTTTGTCATCGACATTTATACCGGTTTACCCGTTGATATTGATGAGTGCCGGGAGATCCCAGGGGTCTGTGAAAATGGAGTGTGTATCAACATGGTTGGCAGCTTCCGATGTGAATGTCCAGTGGGATTCTTCTATAATGACAAGTTGTTGGTTTGTGAAGATATTGACGAGTGTCAGAACGGCCCAGTGTGCCAGCGCAACGCCGAATGCATCAACACTGCAGGCAGCTACCGCTGTGACTGTAAGCCCGGCTACCGCTTCACCTCCACAGGACAGTGCAATGATCGTAATGAATGTCAAGAAATCCCCAATATATGCAGTCATGGGCAGTGCATTGACACAGTTGGAAGCTTTTATTGCCTTTGCCACACTGGTTTTAAAACAAATGATGACCAAACCATGTGCTTGGACATAAATGAATGTGAAAGAGATGCCTGTGGGAATGGAACTTGCCGGAACACAATTGGTTCCTTCAACTGCCGCTGCAATCATGGTTTCATCCTTTCTCACAACAATGACTGTATAGATGTTGATGAATGTGCAAGTGGAAATGGGAATCTTTGCAGAAATGGCCAATGCATTAATACAGTGGGGTCTTTCCAGTGCCAGTGCAATGAAGGCTATGAGGTGGCTCCAGATGGGAGGACCTGTGTGGATATCAATGAATGTCTTCTAGAACCCAGAAAATGTGCACCAGGTACCTGTCAAAACTTGGATGGGTCCTACAGATGCATTTGCCCACCTGGATACAGTCTTCAAAATGAGAAGTGTGAAGATATTGATGAGTGTGTCGAAGAGCCAGAAATTTGTGCCCTGGGCACATGCAGTAACACTGAAGGCAGCTTCAAATGTCTGTGTCCAGAAGGGTTTTCCTTGTCCTCCAGTGGAAGAAGGTGCCAAGATTTGCGAATGAGCTACTGTTATGCGAAGTTTGAAGGAGGAAAGTGTTCATCACCCAAATCCAGAAATCACTCCAAGCAGGAATGCTGCTGTGCCTTGAAGGGAGAAGGCTGGGGAGACCCCTGCGAGCTCTGCCCCACGGAACCTGATGAGGCCTTCCGCCAGATATGTCCTTATGGAAGTGGGATCATCGTGGGACCTGATGATTCAGCAGTTGATATGGACGAATGCAAAGAACCCGATGTCTGTAAACATGGACAGTGCATCAATACAGATGGTTCCTATCGCTGCGAGTGTCCCTTTGGTTATATTCTAGCAGGGAATGAATGTGTAGATACTGATGAATGTTCTGTTGGCAATCCTTGTGGAAATGGAACCTGCAAGAATGTGATTGGAGGTTTTGAATGCACCTGCGAGGAGGGATTTGAGCCCGGTCCAATGATGACATGTGAAGATATAAATGAATGTGCCCAGAATCCTCTGCTCTGTGCCTTCCGATGTGTGAACACTTATGGGTCATATGAATGCAAATGTCCCGTGGGATATGTGCTCAGAGAAGACCGTAGGATGTGCAAAGATGAGGATGAGTGTGAAGAGGGAAAACATGACTGTACTGAAAAACAAATGGAATGCAAGAACCTCATTGGCACATATATGTGCATCTGTGGACCCGGGTATCAGCGGAGACCTGATGGAGAAGGCTGTGTAGATGAGAATGAATGTCAGACGAAGCCAGGGATCTGTGAGAATGGGCGCTGCCTCAACACCCGTGGGAGCTACACCTGTGAGTGTAATGATGGGTTTACCGCCAGCCCCAACCAGGACGAGTGCCTTGACAATCGGGAAGGGTACTGCTTCACAGAGGTGCTACAAAACATGTGTCAGATCGGCTCCAGCAACAGGAACCCCGTCACCAAATCGGAATGCTGCTGTGACGGAGGGAGAGGCTGGGGTCCCCACTGTGAGATCTGCCCTTTCCAGGGGACTGTGGCTTTCAAGAAACTCTGTCCCCATGGCCGAGGATTCATGACCAATGGAGCAGATATCGATGAATGCAAGGTTATTCACGATGTTTGCCGAAATGGGGAATGTGTCAATGACAGAGGATCATATCATTGCATTTGTAAAACTGGGTACACTCCAGATATAACTGGGACTTCCTGTGTAGATCTGAACGAGTGCAACCAGGCTCCCAAACCCTGCAATTTTATCTGCAAAAACACAGAAGGGAGTTACCAGTGTTCATGCCCGAAAGGCTACATTCTGCAAGAGGATGGAAGGAGCTGCAAAGATCTTGATGAGTGTGCAACCAAGCAACACAACTGCCAGTTCCTATGTGTTAACACCATTGGCGGCTTCACATGCAAATGTCCTCCCGGATTTACCCAACACCATACGTCCTGCATTGATAACAATGAATGCACCTCTGACATCAATCTGTGCGGGTCTAAGGGCATTTGCCAGAACACTCCTGGAAGCTTCACCTGTGAATGCCAGCGGGGATTCTCACTTGATCAGACCGGCTCCAGCTGTGAAGACGTGGACGAGTGTGAGGGTAACCACCGCTGCCAGCATGGCTGCCAGAACATCATTGGGGGCTACAGGTGCAGCTGCCCCCAGGGCTACCTCCAGCACTACCAGTGGAACCAGTGTGTTGATGAAAACGAATGCCTCAGCGCTCACATCTGCGGAGGAGCCTCCTGTCACAACACCCTGGGGAGCTACAAGTGCATGTGTCCCGCCGGCTTCCAGTATGAACAGTTCAGTGGAGGATGCCAAGACATCAATGAATGTGGCTCTGCGCAGGCCCCCTGCAGCTATGGCTGTTCCAATACCGAGGGCGGTTACCTGTGTGGCTGTCCACCTGGTTACTTCCGCATAGGCCAAGGGCACTGTGTTTCTGGAATGGGCATGGGCCGAGGAAACCCAGAGCCACCTGTCAGTGGTGAAATGGATGACAATTCACTCTCCCCAGAGGCTTGTTACGAGTGTAAGATCAATGGCTACCCCAAACGGGGCAGGAAACGGAGAAGCACAAACGAAACTGATGCCTCCAATATCGAGGATCAGTCTGAGACAGAAGCCAATGTGAGTCTTGCAAGTTGGGATGTTGAGAAGACAGCCATCTTTGCTTTCAATATTTCCCACGTCAGTAACAAGGTTCGAATCCTAGAACTCCTTCCAGCTCTTACAACTCTGACGAATCACAACAGATACTTGATCGAATCTGGAAATGAAGATGGCTTCTTTAAAATCAACCAAAAGGAAGGGATCAGCTACCTCCACTTCACAAAGAAGAAGCCAGTGGCTGGAACCTATTCATTACAAATCAGTAGTACTCCACTTTATAAAAAGAAAGAACTTAACCAACTAGAAGACAAATATGACAAAGACTACCTCAGTGGTGAACTGGGTGATAATCTGAAGATGAAAATCCAGGTTTTGCTTCATTAATTCACCATCCAGAGACCAAATAATTAAAAGAAAAACAAATATAGATAGGTAGAACTATATTTTCCCCCAATCAGAATCATCATATCATAGGTACAATCTTTCACCAAGTAAATTTGTATAAATAAGCACTATTCTTTGTATTACCAAAGCAAGGTACAGGTGACTACCCTAGTTCAAAACAACCACTTTCTCAGGCTTCTCATGTGTGTAGCTAAGCTACCTTGTCATATGTGTTGATTCTTGAAAACTGGGACGTGTATTTCCATTGGGGGTTGGCCATTTATGCTGACATGCCATCCTTCCAGCAAACGTACGGGAATGTGCTTTCAATTGATGGACTACTCTATTTTTTGCAAATTTGTAAACTTTGCTTCTCCAAATACAAGTACTAGGTTGTCCATTTATGGTACCTATTTGGTGCTAGTAAATTTTCAAACTAGATTTATAAATGCACTGTAATATGTACACAACTTAGAAACCAAATTACAAGTATTCAGTTCCAATACTTCATTAATTTCAATCAACCAAAGTTAGTTCAGTAGCTTATCTCAGTTATGAGTATAATACATTACATGTAAATTAAGTGTGTGTATACTGTAATCGTGCTATTTTTTATCATTGAAACATTTATAAACTAGAATAATAATGCCCTTAATGTGAGGGTTTGTAATGGTGCTTATTAAGACCAAAGACTTGTTAAATGTATACACCAAGTGGTAATGAAATTTCGGTGACTGGCCCACACGTGCATAGAGGTCTGGGAGGACCAGGAAACAGCCTCAGTGGCCAGAGGATCACCAGTGCATCCTTCATCACAGCATGTGCAATATGCCAAGATTACCCTCGGTCATTCCTGTCAACAAGGGGTCAATGTCATAAATGTCACAATAAAACAATCTCTTCTTTTTTTTAGTTTACCCCTTGGCTTTGTGTTCTTGCATGGATTTGGGGTTGGAGGGGCCATTCCGGAGGCTAAATAAAGTCTCCTGGATTTAAATTATCCTGGGTCTCTTACTTATGGCTTATGAAAGTACCAAATGTATAACCACTAGAAGAAAATTTAACATATGAGTCGATCCCTTGTTTTATCCATTGAAAGTAGCAGAGTCTGGTGTCATTAACCTGACTTGCTTGTGAGAAATTTAGATTGTAGAGTCATTTCTGAAACATGACCTAATTCATCTTGTGACTTTTAAATAGTCTTAAATACCAAGTTCAGTCATTGTCTTAGAGCACATGAATTTCATTATAATAGATTTATCATGCCCCCCTCTCAAATATACACAGTTTTGGCAAGCCTTAGGTGTTCTGTTCCATTTTTTTTTCCCCTAAACATCTTTCGTTAGTCAATGCTCATCTAATTACAAAGGGATAATCCCAGACTGTATCCAATTGCTGTAACTTTTGGTTTCTTAATGTCATAATTTTTAAAGTCTGTTTTATTTTAAGTGCAATATTGAGTATTTAGCTGTTAGGCTCAATCCGTCGATATGAAATAATTTTTTAAATCCCTAAGGGCAGGAAAGCATTTCGTGGTAGTGAAAATAAGAGGAAATAAGATGGCATGAAGGTGGTGGGCGGAGAAACTAGGTAGGACACAGGAAAGTGCTCTCAAAAATCTTTGAAGAGCTCAGCTGAAAAAAATGGAGTAGATTTGGCTCATACTATTCCGGAAGGCAAAACCAGGGTCAGCTGATGTCAGCCCCAGTTTAATACACACGGTCCCAATTATAGAGCTACTCACTGAAAGAATGGGTTTCCTTGCATTGTGGTGAGCTCCCTGTCACAAGATAGAAGAGTTTCAGTCTAGGCTTAATGGCAACCATTGGACAAAGATGCTTTCTTCCACCTAACAGGCCATTAACATCTTAAAGGTATTTTTGTATCTCTAATTTTGTTTATAATAGGTGCTCAACAGAATGAGCTGAATGGCTGTTACAAAGGGGGTTTGTACCTTGGGTAAGAGATTAAAATATAACTCAAAATTTCCTTCTAACGCTGCACCTATGGAACCATGTGATAGAGGTGTATTAAAATTGTTATCGAAGAATATATAGCATATGGTAAACAACAGTTTGCATATGGAAAATGTCTTTGATAATTTAACCAGAACTGCATTATATTCAATAACGGATTTTCTTTATAACAAACAACAGGGGAAAATGGAGTTGGCACACAGTGGATCACTTTGATATTTTTAATAGTCCAAGTCTGGATTTTATTTATTCCTGAGCCAACAATTTTGAACAGCATATTTTCCATGTTTCTGACTGTAACAAAACATTTTCCTCATTGTTCCATTGTAAATATTCCTCTTGTTGGAACTCTTTTTAATCCTGAGATTTAAACCTGTACCTTTCAATTGTCTGTGACCTTTCAATTTCACTTTCAATAGTTGAAGAACTTGGCTTTGTAAATCTCTCAGAAGCTTGAAAATATCTTGTCTCTACCCCCTCAGCCCATTTCATTTGCCAATAATTATTTTGTAAGTAGGGTTGAAATGAACTCAGCTGGCCTTGTGAAATGTTTAAACTTGCACAAACAACTACATTTTTGTTCAACAAATAGCAGTTTACTCAGCCAAAATCACTTTGGATATTGCCATTACAAATACTGTTAAACTTCAGAAATCATGTCTGTAAATTAGATGAGCCAAAATAAAGGACAATTGGGTTGATG