Transcript asmbl_53974

Sequence
Transcript Sequence for observation asmbl_53974 of TGE0058660:
GCAAAGAAGGTAAACTAATTACAGGAGAAAGGAAGCACCAGCTTAAATGTGGAGCGTCTCTTGAGAGGCACTGTGGTATAAAGGAAAGCGCATGGATGGCCTTTGCAGTCCAACAGACCTGGCTGTGAATTTCTGCCCTGCTGCTGCTGGCTGTGAGATCTTGGAAGAGCTTTCTGAGCCTCACTTTCTTCAGCTGTAAAACAGAGAATATAATACCTCTTTCTCAGGATTGTTAGGAAAGCTAAGGAAATGGTCAATACCTGTATCCTATCTATCATAAAATAGGTATCTAATAAACATTCATTCCCTTCCCCTTCCTCTCTTCCATAGGAAGTGGTTATTCGCTAAGTGAAGAGAAGGCCAATCTATCTACATTCAAATGAACGTATGCCTGAAAATGGACTATGGCAGTTAAGAAATGTCTTACCAGCAACTTTCCAACCTGCCCTGCAAAGGCAGATCTACAAAAATATATTAGAGACTTCCAAAAATTATAAATCAGAAATAATGAGAAACTCATGGTTTTCCCCCTTCTAGCTGATTTTTTTAAAGTAAGATTTCTTTTTCCTGCTTCTTAGCATCAGACTTGGCAGGTCCCTGTGGGTAGCCAGCCCTGCAGCTTCTGTCTCACTTGTGGGTTTTCCCCAATTACTGCTTGTGAAGTCTGCACCAAATCTCTTCCAGCCACACTTAGTTTTAGACAGGGCTCAGACACTCTGGGCAGGAGGCTGGTTTGAATAAGGAGGGGGCCGATTCGGTGATGGGAGCAGACATACCAGAAGGCATTATTCATCTCCCAGAACAGGTACCTGGGGGCTTTTGCAGAATTTTGAAAAGGAAGTCCAAGTGGGGCAGACACGTGGGGCAGACACTTGGGGCAGGATATCAGCCTTTGCCAGATCAGCATATCCTGAAATAGGCTGACAGGGAAAGCAGCCTGCGGGAAAATGGTTGGTCTCTGCTTTTGAGAGATTTGTCTCCTCGCTGGGCACTTGTGAAGCAAGTACGCAGAGAACTGCAAGATTCCTTTCCTCCCCCCTTGAACCCTAAATCTTAGCTACGGACCAGCCCCATGTTGGTTCATGACCGGATGTTTACATGGAGCAGAAGATACCAGTGTTGACTTCTGATGAGAACTGGAGTCTGCTGGTCCTCAGAATGCCATCCTCTAATGCCCTCTGCCTGGTGCATTTGACTTCATCTTCCATGTTTCATCTTCCATGTTTACTCACAACATAGCAAGAAGCCACATCCATGCCCGCATCTTTCTCTGCTGTTGCTCTCCCCACCCAGCCACCTCTGCCTGTCTTACCTTCCTGAGAGCCTAGCTGAGGGCCAGCTGGCCGGCAGCAAGTGGCCAGATCCAATGTCCTCAATAGAAATCTCTGGCTGCTGCCACACATGCCGCTTCTTATTTTGCCTGCAGATGAAAACGAATGCCTCAGCGCTCACATCTGCGGAGGAGCCTCCTGTCACAACACCCTGGGGAGCTACAAGTGCATGTGTCCCGCCGGCTTCCAGTATGAACAGTTCAGTGGAGGATGCCAAGACATCAATGAATGTGGCTCTGCGCAGGCCCCCTGCAGCTATGGCTGTTCCAATACCGAGGGCGGTTACCTGTGTGGCTGTCCACCTGGTTACTTCCGCATAGGCCAAGGGCACTGTGTTTCTGGAATGGGCATGGGCCGAGGAAACCCAGAGCCACCTGTCAGTGGTGAAATGGATGACAATTCACTCTCCCCAGAGGCTTGTTACGAGTGTAAGATCAATGGCTACCCCAAACGGGGCAGGAAACGGAGAAGCACAAACGAAACTGATGCCTCCAATATCGAGGATCAGTCTGAGACAGAAGCCAATGTGAGTCTTGCAAGTTGGGATGTTGAGAAGACAGCCATCTTTGCTTTCAATATTTCCCACGTCAGTAACAAGGTTCGAATCCTAGAACTCCTTCCAGCTCTTACAACTCTGACGAATCACAACAGATACTTGATCGAATCTGGAAATGAAGATGGCTTCTTTAAAATCAACCAAAAGGAAGGGATCAGCTACCTCCACTTCACAAAGAAGAAGCCAGTGGCTGGAACCTATTCATTACAAATCAGTAGTACTCCACTTTATAAAAAGAAAGAACTTAACCAACTAGAAGACAAATATGACAAAGACTACCTCAGTGGTGAACTGGGTGATAATCTGAAGATGAAAATCCAGGTTTTGCTTCATTAATTCACCATCCAGAGACCAAATAATTAAAAGAAAAACAAATATAGATAGGTAGAACTATATTTTCCCCCAATCAGAATCATCATATCATAGGTACAATCTTTCACCAAGTAAATTTGTATAAATAAGCACTATTCTTTGTATTACCAAAGCAAGGTACAGGTGACTACCCTAGTTCAAAACAACCACTTTCTCAGGCTTCTCATGTGTGTAGCTAAGCTACCTTGTCATATGTGTTGATTCTTGAAAACTGGGACGTGTATTTCCATTGGGGGTTGGCCATTTATGCTGACATGCCATCCTTCCAGCAAACGTACGGGAATGTGCTTTCAATTGATGGACTACTCTATTTTTTGCAAATTTGTAAACTTTGCTTCTCCAAATACAAGTACTAGGTTGTCCATTTATGGTACCTATTTGGTGCTAGTAAATTTTCAAACTAGATTTATAAATGCACTGTAATATGTACACAACTTAGAAACCAAATTACAAGTATTCAGTTCCAATACTTCATTAATTTCAATCAACCAAAGTTAGTTCAGTAGCTTATCTCAGTTATGAGTATAATACATTACATGTAAATTAAGTGTGTGTATACTGTAATCGTGCTATTTTTTATCATTGAAACATTTATAAACTAGAATAATAATGCCCTTAATGTGAGGGTTTGTAATGGTGCTTATTAAGACCAAAGACTTGTTAAATGTATACACCAAGTGGTAATGAAATTTCGGTGACTGGCCCACACGTGCATAGAGGTCTGGGAGGACCAGGAAACAGCCTCAGTGGCCAGAGGATCACCAGTGCATCCTTCATCACAGCATGTGCAATATGCCAAGATTACCCTCGGTCATTCCTGTCAACAAGGGGTCAATGTCATAAATGTCACAATAAAACAATCTCTTCTTTTTTTTAGTTTACCCCTTGGCTTTGTGTTCTTGCATGGATTTGGGGTTGGAGGGGCCATTCCGGAGGCTAAATAAAGTCTCCTGGATTTAAATTATCCTGGGTCTCTTACTTATGGCTTATGAAAGTACCAAATGTATAACCACTAGAAGAAAATTTAACATATGAGTCGATCCCTTGTTTTATCCATTGAAAGTAGCAGAGTCTGGTGTCATTAACCTGACTTGCTTGTGAGAAATTTAGATTGTAGAGTCATTTCTGAAACATGACCTAATTCATCTTGTGACTTTTAAATAGTCTTAAATACCAAGTTCAGTCATTGTCTTAGAGCACATGAATTTCATTATAATAGATTTATCATGCCCCCCTCTCAAATATACACAGTTTTGGCAAGCCTTAGGTGTTCTGTTCCATTTTTTTTTCCCCTAAACATCTTTCGTTAGTCAATGCTCATCTAATTACAAAGGGATAATCCCAGACTGTATCCAATTGCTGTAACTTTTGGTTTCTTAATGTCATAATTTTTAAAGTCTGTTTTATTTTAAGTGCAATATTGAGTATTTAGCTGTTAGGCTCAATCCGTCGATATGAAATAATTTTTTAAATCCCTAAGGGCAGGAAAGCATTTCGTGGTAGTGAAAATAAGAGGAAATAAGATGGCATGAAGGTGGTGGGCGGAGAAACTAGGTAGGACACAGGAAAGTGCTCTCAAAAATCTTTGAAGAGCTCAGCTGAAAAAAATGGAGTAGATTTGGCTCATACTATTCCGGAAGGCAAAACCAGGGTCAGCTGATGTCAGCCCCAGTTTAATACACACGGTCCCAATTATAGAGCTACTCACTGAAAGAATGGGTTTCCTTGCATTGTGGTGAGCTCCCTGTCACAAGATAGAAGAGTTTCAGTCTAGGCTTAATGGCAACCATTGGACAAAGATGCTTTCTTCCACCTAACAGGCCATTAACATCTTAAAGGTATTTTTGTATCTCTAATTTTGTTTATAATAGGTGCTCAACAGAATGAGCTGAATGGCTGTTACAAAGGGGGTTTGTACCTTGGGTAAGAGATTAAAATATAACTCAAAATTTCCTTCTAACGCTGCACCTATGGAACCATGTGATAGAGGTGTATTAAAATTGTTATCGAAGAATATATAGCATATGGTAAACAACAGTTTGCATATGGAAAATGTCTTTGATAATTTAACCAGAACTGCATTATATTCAATAACGGATTTTCTTTATAACAAACAACAGGGGAAAATGGAGTTGGCACACAGTGGATCACTTTGATATTTTTAATAGTCCAAGTCTGGATTTTATTTATTCCTGAGCCAACAATTTTGAACAGCATATTTTCCATGTTTCTGACTGTAACAAAACATTTTCCTCATTGTTCCATTGTAAATATTCCTCTTGTTGGAACTCTTTTTAATCCTGAGATTTAAACCTGTACCTTTCAATTGTCTGTGACCTTTCAATTTCACTTTCAATAGTTGAAGAACTTGGCTTTGTAAATCTCTCAGAAGCTTGAAAATATCTTGTCTCTACCCCCTCAGCCCATTTCATTTGCCAATAATTATTTTGTAAGTAGGGTTGAAATGAACTCAGCTGGCCTTGTGAAATGTTTAAACTTGCACAAACAACTACATTTTTGTTCAACAAATAGCAGTTTACTCAGCCAAAATCACTTTGGATATTGCCATTACAAATACTGTTAAACTTCAGAAATCATGTCTGTAAATTAGATGAGCCAAAATAAAGGACAATTGGGTTGATG