Transcript asmbl_53809

Sequence
Transcript Sequence for observation asmbl_53809 of TGE0058659:
GCCGAGCCGACCCGCCCCGCCGACGAACCCCCTGAAGCTGTGCCAAGATGTGTGACGACGAGGAGACCACCGCCCTGGTGTGCGACAACGGCTCTGGGCTGGTGAAGGCCGGCTTTGCGGGCGATGACGCGCCCCGCGCTGTCTTCCCGTCCATCGTGGGCCGCCCGCGGCACCAGGGAGTTATGGTGGGTATGGGTCAGAAGGACTCCTACGTAGGTGATGAAGCCCAGAGCAAGAGAGGCATCCTGACCCTGAAGTATCCCATCGAGCATGGTATCATCACCA