Transcript asmbl_53398

Sequence
Transcript Sequence for observation asmbl_53398 of TGE0056216:
AGAAGAAGAAAAAGAAAAAGAAGAGAAAGAGTCGGAAGACAAACCTGAAATTGAAGATGTTGGTTCTGATGAGGAAGAAGAAAAGAAGGATGGTGACAAGAAGAAGAAGAAGAAGATTAAGGAAAAGTACATCGATCAAGAAGAGCTCAACAAAACAAAGCCCATCTGGACCAGAAATCCCGACGATATTACTAATGAGGAGTACGGAGAATTCTATAAGAGCTTGACCAATGACTGGGAAGATCACTTGGCAGTGAAGCATTTTTCAGTTGAAGGACAGTTGGAATTCAGAGCCCTTCTATTTGTCCCACGACGTGCTCCTTTTGATCTGTTTGAAAACAGAAAGAAAAAGAACAACATCAAATTGTATGTACGCAGAGTTTTCATCATGGATAACTGTGAGGAGCTAATCCCTGAATATCTGAACTTCATTAGAGGGGTGGTAGACTCGGAGGATCTCCCTCTAAACATATCCCGTGAGATGTTGCAACAAAGCAAAATTTTGAAAGTTATCAGGAAGAATTTGGTCAAAAAATGCTTAGAACTCTTTACTGAACTGGCGGAAGATAAAGAGAACTACAAGAAATTCTATGAGCAGTTCTCTAAAAACATAAAGCTTGGAATACACGAAGACTCTCAAAATCGGAAGAAGCTTTCAGAGCTGTTAAGGTACTACACATCTGCCTCTGGTGATGAGATGGTTTCTCTCAAGGACTACTGCACCAGAATGAAGGAGAACCAGAAACATATCTATTATATCACAGGTGAGACCAAGGACCAGGTAGCTAACTCAGCCTTTGTGGAACGTCTTCGGAAACATGGCTTAGAAGTGATCTATATGATTGAGCCCATTGATGAGTACTGTGTCCAACAGCTGAAGGAATTTGAGGGGAAGACTTTAGTGTCAGTCACCAAAGAAGGCCTGGAACTTCCAGAGGATGAAGAAGAGAAAAAGAAGCAGGAAGAGAAAAAAACAAAGTTTGAGAACCTCTGCAAAATCATGAAAGACATATTGGAGAAAAAAGTTGAAAAGGTGGTTGTGTCAAACCGATTGGTGACATCTCCATGCTGTATTGTCACAAGCACATATGGCTGGACAGCAAACATGGAGAGAATCATGAAAGCTCAAGCCCTAAGAGACAACTCAACAATGGGTTACATGGCAGCAAAGAAACACCTGGAGATAAACCCTGACCATTCCATTATTGAGACCTTAAGGCAAAAGGCAGAGGCTGATAAGAACGACAAGTCTGTGAAGGATCTGGTCATCTTGCTTTATGAAACTGCGCTCCTGTCTTCTGGCTTCAGTCTGGAAGATCCCCAGACACATGCTAACAGGATCTACAGGATGATCAAACTTGGTCTGGGTATTGATGAAGATGACCCTACTGCTGATGATACCAGTGCTGCTGTAACTGAAGAAATGCCACCCCTTGAAGGAGATGACGACACATCACGCATGGAAGAAGTAGACTAATCTCTGGCTGAGGGATGACTTACCTGTTCAGTACTCTACAATTCCTCTGATAATATATTTTCAAGGATGTTTTTCTTTATTTTTGTTAATATTAAAAAGTCTGTATGGCATGACAACTACTTTAAGGGGAAGATAAGATTTCTGTCTACTAAGTGATGCTGTGATACCTTAGGCACTAAAGCAGAGCTAGTAATGCTTTTTGAGTTTCATGTTGGTTTATTTTCACAGATTGGGGTAACGTGCACTGTAAGACGTATGTAACATGATGTTAACTTTGTG