Transcript asmbl_53018

Sequence
Transcript Sequence for observation asmbl_53018 of TGE0058657:
GGGTGGAGCGCGGGGAGCCAGGCGAGGGGCCGCGACGACGGGACTCCATTAGCCGCTCCGGCCACAGGCAGCGCTTCGCCAGCCGAGGAACCGGACGCGGACACCGCCGCCCCGCGAGCCTCCAGCCCCTCGCCTGTTGCCGCGCGAGTCCCGGGCCCGGAGCGCTAGGAGCGCGCGGAAGGAGCCATGGCTCTGGACGGGATAAGGATGCCAGATGGCTGCTACGCGGACGGGACGTGGGAACTGAGTGTCCATGTGACGGACCTGAACCGCGATGTCACCCTGAGAGTGACCGGCGAGGTGCACATTGGAGGCGTGATGCTTAAGCTGGTGGAGAAACTCGATGTAAAAAAAGATTGGTCTGACCATGCTCTCTGGTGGGAAAAGAAGAGAACTTGGCTTCTGAAGACACATTGGACCTTAGATAAGTATGGTATTCAGGCAGATGCTAAGCTTCAGTTCACCCCTCAGCACAAACTGCTCCGCCTGCAGCTTCCCAACATGAAGTATGTGAAGGTGAAAGTGAATTTCTCTGATAGAGTCTTCAAAGCTGTTTCTGACATCTGTAAGACTTTTAATATCAGACACCCCGAAGAACTTTCTCTCTTAAAGAAACCCAGAGATCCAACAAAGAAAAAAAAGAAGAAGCTAGATGACCAGTCTGAAGATGAGGCACTTGAATTAGAGGGGCCTCTTATCACTCCTGGATCAGGAAGTATATATTCAAGCCCAGGACTGTATAGTAAAACAATGACCCCCACTTATGATGCTCATGATGGAAGCCCCTTGTCACCAACTTCTGCTTGGTTTGGTGACAGTGCTTTGTCAGAAGGCAATCCTGGTATACTTGCTGTCAGTCAACCAATCACGTCACCAGAAATCTTGGCAAAAATGTTCAAGCCTCAAGCTCTTCTTGATAAAGCAAAAATCAACCAAGGATGGCTTGATTCCTCAAGATCTCTCATGGAACAAGATGTGAAGGAAAATGAGGCCTTGCTGCTCCGATTCAAGTATTACAGCTTTTTTGATTTGAATCCAAAGTATGATGCAATCAGAATCAATCAGCTTTACGAGCAGGCCAAATGGGCCATTCTCCTGGAAGAGATTGAATGCACAGAAGAAGAAATGATGATGTTTGCAGCCCTGCAGTATCATATCAATAAGCTGTCAATCATGACATCAGAGAATCATTTGAACAACAGTGACAAAGAAGTTGATGAAGTTGATGCTGCCCTTTCAGACCTGGAGATTACTCTGGAAGGGGGTAAAACGTCAACAATTTTGGGTGACATTACTTCCATTCCTGAACTTGCTGACTACATTAAAGTTTTCAAGCCAAAAAAGCTGACTCTGAAAGGTTACAAACAATATTGGTGCACCTTCAAAGACACATCCATTTCTTGTTATAAGAGCAAAGAAGAATCCAGTGGCACACCAGCTCATCAGATGAACCTCAGGGGATGTGAAGTTACCCCAGATGTAAACATTTCAGGCCAAAAATTTAACATTAAACTCCTGATTCCAGTTGCAGAAGGCATGAATGAAATCTGGCTTCGTTGTGACAATGAAAAACAGTATGCACACTGGATGGCAGCCTGCAGATTAGCCTCCAAAGGCAAGACCATGGCGGACAGTTCTTACAACTTAGAAGTTCAGAATATTCTTTCCTTTCTGAAGATGCAGCATTTAAACCCAGATCCTCAGTTAATACCAGAGCAGATCACGACTGATATAACTCCTGAATGTTTGGTGTCTCCCCGCTATCTAAAAAAGTATAAGAACAAGCAGCCAGGCTATATAAGAGATTTGATAACAGCGAGAATCTTGGAGGCCCATCAGAATGTAGCTCAGATGAGTCTAATTGAAGCCAAGATGAGATTTATTCAAGCTTGGCAGTCACTACCTGAATTTGGCATCACTCACTTCATTGCAAGGTTCCAAGGGGGCAAAAAA