Transcript asmbl_53010

Sequence
Transcript Sequence for observation asmbl_53010 of TGE0056907:
CCAGGTTCGAGGCTGGCGCGGCGCGGAGAGTGGGCTGGAGGCCGGGGCGGGACGCGTTGTGCAGCGGGTAAGCGCACGGCCGAGCGAGCATGGAGGGGGACCGGGTGGCCGGGCGGCCGGTGCTGTCGTCGTTACCAGTGCTACTGCTGCTGCCGTTGCTAATGTTGCGGGCCGCGGCGCTGCACCCAGACGAGCTCTTCCCACACGGGGAGTCGTGGGGGGACCAGCTCCTGCAGGAAGGCGACGACGAAAGCTCAGCCGTGGTGAAGCTGGCGAATCCCCTGCACTTCTACGAAGCCCGATTCAGCAACCTCTACGTGGGCACCAACGGCATCATCTCCACTCAGGACTTCCCCAGGGAAACGCAGTATGTGGACTATGATTTCCCCACCGACTTCCCGGCCATCGCCCCTTTTCTGGCGGACATCGACACGAGCCACGGCAGAGGCCGAGTCCTGTACCGAGAGGACACCTCCCCCGCAGTGCTGGGCCTGGCCGCCCGCTATGTGCGCGCTGGCTTCCCGCGCTCTGCGCGCTTTACCCCCACCCACGCCTTCCTGGCCACCTGGGAGCAGGTAGGCGCTTACGAGGAGGTCAAGCGCGGGGCGCTGCCCTCGGGAGAGCTGAACACTTTCCAGGCAGTTTTGGCATCTGATGGGTCTGATAGCTACGCCCTCTTTCTTTATCCTGCCAACGGCCTGCAGTTCCTTGGAACCCGCCCCAAAGAGTCTTACAATGTCCAGCTTCAGCTTCCAGCTCGGGTGGGCTTCTGCCGAGGGGAGGCTGATGATCTGAAGTCAGAAGGACCATATTTCAGCTTGACTAGCACTGAACAGTCTGTGAAAAATCTCTATCAACTAAGCAACCTGGGGATCCCTGGAGTGTGGGCTTTCCATATCGGCAGCACTTCCCCGTTGGACAATGTCAGGCCAGCTGCAGTTGGAGACCTTTCCGCTGCCCACTCTTCTGTTCCCCTGGGACGTTCCTTCAGCCATGCTACAGCCCTGGAAAGTGACTATAATGAGGACAATTTGGATTACTATGATGTGAATGAGGAGGAAGCTGAATACCTTCCGGGTGAACCAGAGGAGGCATTGAATGGCCACAGCAGCATTGATGTTTCCTTCCAATCCAAAGTGGATACAAAGCCTTTAGAGGGTAGGATCTCCCCTCCAGATTCTGATCTGTCCTCCCCCTTGCATCCAACACCTACTTATTGGCCATTCTATCCTGAAACAGAATCTTCCACCTTGGATCCTCACACCAAAGAAGGAACATCTCTGGGAGAGGTAGGGGGCCCAGATTTAAAAGGCCAAGTTGAGCCCTGGGATGAGAGAGAGACCAGAAGCCCAGCTCCACCAGAGGTAGACAGAGATTCACTGGCTCCTTCCTGGGAAACCCCACCACCGTACCCCGAAAACGGAAGCATCCAGCCCTACCCAGATGGAGGGCCAGTGCCTTCGGAAATGGATGTTCCCCCAGCTCATCCTGAAGAAGAAATTGTTCTTCGAAGTTACCCTGCTTCAGGTCACACTACACCCTTAAGTCGAGGGACGTATGAGGTGGGACTGGAAGACAACATAGGTTCCAACACCGAGGTCTTCACGTATAATGCTGCCAACAAGGAAACCTGTGAACACAACCACAGACAATGCTCCCGGCATGCCTTCTGCACGGACTATGCCACTGGCTTCTGCTGCCACTGCCAATCCAAGTTTTATGGAAATGGGAAGCACTGTCTGCCTGAAGGGGCACCTCACCGAGTGAATGGGAAAGTGAGTGGCCACCTCCACGTGGGCCATACACCCGTGCACTTCACTGATGTGGACCTGCATGCGTATATCGTGGGCAATGATGGCAGAGCCTACACGGCCATCAGCCACATCCCACAGCCAGCAGCCCAGGCCCTCCTCCCCCTCACACCAATTGGAGGCCTGTTTGGCTGGCTCTTTGCTTTAGAAAAACCTGGCTCTGAGAACGGCTTCAGCCTCGCAGGTGCTGCCTTTACCCATGACATGGAAGTTACATTCTACCCGGGAGAGGAGACGGTTCGTATCACTCAAACTGCTGAGGGACTTGACCCAGAGAACTACCTGAGCATTAAGACCAACATTCAAGGCCAGGTGCCTTACGTCTCAGCAAATTTCACAGCCCACATCTCTCCCTACAAGGAGCTGTACCACTACTCCGACTCCACTGTGACCTCTACAAGTTCCAGAGACTACTCTCTGACTTTTGGTGCAATCAACCAAACATGGTCCTACCGCATCCACCAGAACATCACTTACCAGGTGTGCAGGCACGCCCCCAGACACCCGTCCTTCCCCACCACCCAGCAGCTGAACGTGGACCGGGTCTTTGCCTTGTATAATGACGAAGAAAGAGTGCTTAGATTTGCTGTGACCAATCAAATTGGCCCGGTCAAAGAGGATTCAGACCCCACTCCGGGGAATCCTTGCTATGATGGGAGCCACATGTGTGACACAACAGCACGGTGCCATCCAGGGACAGGTGTAGATTACACCTGTGAGTGCGCATCTGGGTACCAGGGAGATGGACGGAACTGTGTGGATGAAAATGAATGTGCAACTGGCTTTCATCGCTGTGGCCCCAACTCTGTATGTATCAACTTGCCTGGAAGCTACAGGTGTGAGTGCCGGAGTGGTTATGAGTTTGCAGATGACCGGCATACTTGCATCTTGATCACCCCACCTGCCAACCCCTGTGAGGATGGCAGTCATACCTGTGCTCCTGCTGGGCAGGCCCGGTGTGTTCACCATGGAGGCAGCACGTTCAGCTGTGCCTGCCTGCCTGGTTATGCCGGCGATGGGCACCAGTGCACTGATGTAGATGAATGCTCAGAAAACAGATGTCACCCTGCAGCTACCTGCTACAATACTCCTGGTTCCTTCTCCTGCCGTTGTCAACCCGGATATTATGGGGATGGATTTCAGTGCATACCTGACTCCACCTCAAGCCTGACACCCTGTGAACAACAGCAGCGCCATGCCCAGGCCCAGTATGCCTACCCTGGGGCCCGGTTCCACATCCCCCAATGCGACGAGCAGGGCAACTTCCTGCCCCTACAGTGTCATGGCAGCACTGGTTTCTGCTGGTGCGTGGACCCTGATGGTCATGAAGTTCCTGGTACCCAGACTCCACCTGGCTCCACCCCGCCTCACTGTGGACCATCACCAGAGCCCACCCAGAGGCCCCCGACCATCTGTGAGCGCTGGAGGGAAAACCTGCTGGAGCACTACGGTGGCACCCCCCGGGATGACCAGTACGTGCCCCAGTGCGATGACCTGGGCCACTTCATCCCCCTGCAGTGCCACGGAAAGAGCGACTTCTGCTGGTGTGTGGACAAAGATGGCAGAGAGGTGCAGGGCACCCGCTCCCAGCCAGGCACCACCCCTGCGTGTATACCCACCGTCGCTCCACCCATGGTCCGGCCCACGCCCCGGCCAGATGTGACCCCTCCATCTGTGGGCACCTTCCTGCTCTATACTCAGGGCCAGCAGATTGGCTACTTACCCCTCAATGGCACCAGGCTTCAGAAGGATGCAGCTAAGACCCTGCTGTCTCTGCATGGCTCCATAATCGTGGGAATTGATTACGACTGCCGGGAGAGGATGGTGTACTGGACAGATGTTGCTGGACGGACAATCAGCCGTGCTGGTCTGGAACTGGGAGCAGAGCCTGAGACGATCGTGAATTCAGGTCTGATAAGCCCTGAAGGACTTGCCATAGACCACATCCGCAGAACAATGTACTGGACGGACAGTGTCCTGGATAAGATAGAGAGCGCCCTGCTGGATGGCTCTGAGCGCAAGGTCCTCTTCTACACAGATCTGGTGAATCCCCGTGCCATCGCTGTGGATCCAATCCGAGGCAACTTGTACTGGACAGACTGGAATAGAGAAGCTCCTAAAATTGAAACGTCATCTTTAGATGGAGAAAACAGAAGAATTCTGATCAATACAGACATTGGATTGCCCAATGGCTTAACCTTTGACCCTTTCTCTAAACTGCTCTGCTGGGCAGATGCAGGAACCAAAAAACTGGAGTGTACACTACCTGATGGAACTGGACGGCGTGTCATTCAAAACAACCTCAAGTACCCCTTCAGCATCGTAAGCTATGCAGATCACTTCTACCACACAGACTGGAGGAGGGATGGTGTTGTATCAGTAAATAAACATAGTGGCCAGTTTACTGATGAGTATCTCCCAGAACAACGATCTCACCTCTACGGGATAACTGCAGTCTACCCCTACTGCCCAACAGGAAGAAAGTAAGTACAGTAATGTAAAGGAAGACTTGGAGTTTACAATCAGAACCTGGACCCTAAAGAACAGTGACTGCAAAGGCAAAGAAAGTAAAAAAGGAATTGGCCATTAGACGTTCCTGAGCATCCAAGATGAACATTTTGTAGTGCAAAAAGACTTTTGTGAAAAGCTGATACCTCAATCTTTACTACTGTATTTTTAAAAATGAAGGTTGTTATTGCAAGTTTAAAAAGGTAACAGAATTTTAACTGTTGCTTATTAAAGCAACTTCTTGTAAACATTTATCATTAATATTTAAAAGATCAAATTCATTCAACTAAGAATTAGAGTTTAAGACTCTAAACCTGATTTTTGCCATGGATTCCTTCTGGCCAAGAAATTAAAGCACATGTGATCAATATAACAATATAATCCTAAACCTTGACAGTTGGAGAAGCCAATGCAGAACTGATGGGAAAGGACCAATTATTTATAGTTTCCCAACAAAAGTTCTAAGATTTTTTACCTCTGCATCAGTGCATTTCTATTTATATCAAAAGGTGCTAAAATGATTCAATTTGCATTTTCTGATCCTGTAGTGCCTCTATAGAAGTACCCACAGAAAGTAAAGTATCACATTTATAAATACCAAAGATGTAACAATTTTAAAATTTTCTAGATTACTCCAATAAAGTGTTTTAAGTTTTCCTATGACTTAAGGATCTATATTGTCTCTAGGACAAAGCTGGGGGTTGGCATATATGCCTTAACCACAAAGGAGAAAGGTGATTTATGCAAACATACAGTACATAATAAAAATTCTACTTTCCTAAACTTTATTAAAGAAAAAAGCAATAAGCAATGGTGGTAAATCTCTAGAACATACCCAATTTTCTGGGCTTCCTCCCCCGAGAATGTGACATTTTGATTTCCAAACATGCCAGAAGTGTATGGTTCCCAACTGTACTAAGTAGGTGAGAAGCTGAAGTCCTCAAGTGTTCATCTTCCAACTTTTCCCAGTCTGTGGTCTGTCTTTGGATCAGCAATAATTGCCTGAACAGCTACTATGGCTTCGTTGATTTTTGTCTGTAGCTCTCTGAGCTCCTCTATGTGCAG