Transcript asmbl_52539

Sequence
Transcript Sequence for observation asmbl_52539 of TGE0058655:
ATAAGAGGTGCCAGTATTCTACAAAATGAAAACTCAAACTATTATTTAACTGTGTTCTTCATTTGCAGGTTTGGCTTCAGTATCAGTGTTTATGGGATATGCAAGCTGAAAACATCTATAACAGACTTGGAGAAGATCTCAACAAATGGCAGGCTCTCCTGGTCCAAATAAGGAAGGCCAGAGGAACCTTTGACAATGCAGAAACCAAGAAAGAGTTTGGACCAGTAGTTATAGATTATGGCAAGGTACAATCTAAGGTGAACTTGAAATATGACTCTTGGCATAAGGAGGTTCTTAGCAAATTTGGGCAGATGCTAGGATCAAACATGACGGAATTCCATTCCCAGATCTCAAAGTCCCGCCAAGAGTTGGAGCAGCACTCAGTAGACACGGCCAGCACCTCCGATGCAGTGACCTTCATCACCTATGTGCAGTCTTTGAAACGGAAGATCAAGCAGTTTGAGAAGCAAGTTGAGCTCTACCGCAATGGCCAGCGCTTACTGGAAAAGCAAAGGTTCCAGTTCCCACCTTCCTGGCTTTATATTGACAACATCGAGGGAGAGTGGGGAGCCTTCAATGACATCATGCGGCGAAAGGACTCTGCCATTCAGCAGCAGGTGGCAAACCTGCAAATGAAGATTGTCCAGGAGGATCGGGCCGTGGAAAGCCGCACCACCGACCTGCTGACTGACTGGGAGAAGACCAAGCCTGTCACGGGCAACCTTCGCCCAGAAGAGGCACTTCAGGCTCTCACCATATATGAGGGGAAGTTTGGTAGGCTGAAGGACGACAGAGAGAAGTGTGCAAAGGCCAAGGAGGCGCTGGAATTGACAGATACTGGGCTTCTCAGTGGCAGTGAAGAGCGCGTGCAGGTGGCCTTAGAAGAATTACAGGACCTCAAAGGCGTTTGGTCAGAACTTTCTAAGGTTTGGGAGCAAATCGATCAGATGAAGGAGCAACCCTGGGTTTCAGTACAGCCTCGAAAGCTTCGACAAAATTTGGATGCCCTCCTGAACCAGCTGAAAAGCTTCCCTGCCCGGTTGCGACAGTATGCGTCCTATGAGTTTGTTCAGAGGCTTCTGAAAGGTTACATGAAGATAAATATGCTGGTGATTGAACTGAAATCCGAAGCACTTAAAGACCGCCATTGGAAACAGCTCATGAAAAGGCTTCACGTTAATTGGGTTGTTTCTGAGCTAACCCTTGGCCAAATCTGGGATGTTGACTTGCAGAAAAATGAAGCGATTGTCAAGGATGTACTGCTTGTGGCACAAGGGGAGATGGCTTTGGAAGAATTTTTGAAGCAGATAAGAGAAGTGTGGAATACTTATGAACTAGACTTGGTTAATTATCAGAACAAGTGCCGCTTGATCCGTGGCTGGGATGACCTCTTCAACAAGGTCAAAGAACACATCAACAGCGTCTCGGCCATGAAGCTCTCTCCGTATTACAAGGTTTTTGAAGAGGATGCTCTCAGCTGGGAAGATAAGCTGAACAGGATCATGGCTCTCTTTGATGTGTGGATTGATGTGCAGAGGCGGTGGGTCTACCTGGAAGGTATCTTCACAGGCAGTGCAGATATCAAGCACCTGCTGCCAGTGGAAACCCAGCGGTTTCAGAGCATCAGCACTGAGTTTTTGGCTCTAATGAAAAAAGTGTCCAAGTCTCCCCTTGTTATGGATGTTCTGAACATCCAGGGAGTACAGAGGTCTCTGGAAAGATTGGCAGACCTGCTAGGAAAGATCCAGAAAGCATTGGGAGAATATCTGGAAAGAGAGCGGTCATCTTTCCCCAGGTTCTATTTTGTGGGTGATGAAGATTTGCTTGAAATCATTGGAAACAGCAAGAATGTCGCTAAATTACAGAAACACTTCAAGAAGATGTTTGCTGGAGTTTCGAGCATCATCCTGAACGAGGATAACTCTGTTGTTTTGGGTATTTCATCTCGGGAAGGAGAGGAGGTTATGTTTAAAACTCCTGTGTCAATTACTGAACATCCCAAAATCAATGAGTGGCTCACATTGGTAGAAAAGGAGATGAGAGTCACCCTGGCCAAACTGCTTGCTGAGTCTGTTACGGAAGTTGAGATTTTTGGTAAAGCAACTTCAATTGACCCAAATACCTACATCACTTGGATTGATAAATACCAGGCCCAGCTTGTGGTTTTGTCAGCCCAGATAGCCTGGTCTGAGAACGTGGAGACCGCACTGAGCAGCATGGGCGGAGGTGGAGATGCCGCGCCCTTGCACTCTGTGCTGAGCAATGTGGAGGTCACCCTCAATGTGTTAGCAGACTCTGTCCTCATGGAGCAGCCCCCACTCCGAAGGCGGAAGCTAGAACACTTGATTACAGAGTTGGTTCACCAGAGAGATGTTACAAGGTCCTTGATCAAAAGCAAGATTGACAACGCCAAATCTTTTGAATGGCTCAGCCAGATGCGATTTTACTTTGACCCTAAGCAAACTGATGTGTTACAGCAGTTGTCAATTCAAATGGCAAATGCCAAATTTAACTATGGCTTTGAGTACCTGGGTGTTCAGGACAAACTGGTCCAGACCCCCCTCACTGACCGCTGCTATTTGACAATGACACAAGCCTTGGAGGCCAGGCTGGGGGGTTCCCCATTTGGACCTGCTGGAACTGGGAAAACAGAGTCTGTCAAAGCTCTTGGCCATCAGCTTGGACGGTTTGTTTTAGTTTTCAACTGTGATGAAACCTTTGATTTCCAGGCAATGGGCCGGATCTTTGTGGGCCTTTGCCAGGTGGGTGCCTGGGGCTGCTTTGACGAGTTCAACCGCCTGGAGGAGCGGATGCTCTCGGCTGTGTCCCAGCAGGTGCAGTGCATACAGGAAGCACTGCGTGAACATTCCAACCCCAACTACGACAAGACCTCTGCCCCCATTACTTGTGAGCTGCTGAACAAACAAGTCAAGGTGAGCCCGGACATGGCCATCTTCATCACCATGAACCCTGGCTACGCGGGCCGGTCTAACCTTCCTGACAACTTGAAGAAGCTGTTCCGGAGCTTGGCCATGACCAAGCCCGACCGGCAGTTAATCGCCCAGGTCATGCTGTACTCACAGGGTTTCCGCACTGCTGAAGTGCTTGCCAACAAAATCGTCCCGTTTTTTAAACTATGCGATGAGCAGCTCTCTTCCCAAAGCCATTATGACTTCGGTCTTCGGGCTTTGAAGAGTGTGCTGGTGAGTGCAGGCAATGTGAAGAGAGAGAGAATCCAGAAGATAAAGAGGGAGAAAGAGGAACGAGGGGAAGCAGTTGATGAAGGAGAAATTGCTGAAAATCTCCCTGAACAAGAGATTCTGATACAGAGCGTCTGTGAGACGATGGTGCCAAAGCTGGTGGCAGAGGACATCCCGCTGCTCTTCAGCCTCCTGTCGGACGTGTTCCCTGGAGTCCAGTATCACAGGGGTGAGATGACTGCCCTTCGAGAGGAGCTGAAGAAAGTGTGTCAGGAGATGTATTTGACATATGGAGATGGAGAAGAAGTTGGTGGAATGTGGGTTGAAAAGGTTCTCCAGCTCTATCAGATCACCCAGATCAATCATGGCCTGATGATGGTGGGGCCCTCGGGAAGTGGGAAGAGCATGGCCTGGCGTGTCCTGCTGAAGGCATTGGAGAGACTCGAGGGTGTGGAAGGTGTGGCCCATATCATCGACCCCAAGGCCATCAGCAAAGACCACCTCTACGGAACCCTGGACCCCAACACCAGGGAATGGACAGATGGGCTCTTCACACACGTGCTGAGAAAGATCATCGACAGCGTGAGAGGCGAGCTGCAGAAGCGCCAGTGGATCGTCTTCGATGGCGATGTGGATCCAGAGTGGGTTGAGAACTTGAACTCAGTGCTGGATGACAATAAGCTCCTAACTTTGCCCAATGGAGAGCGCCTCAGTCTTCCACCCAATGTGAGAATAATGTTTGAGGTACAGGACTTGAAATACGCGACCTTGGCCACAGTGTCGCGCTGCGGCATGGTCTGGTTCAGTGAGGATGTGCTGAGCACCGACATGATCTTCAACAACTTCCTGGCCAGGCTGCGCAGCATCCCGCTGGATGAAGGGGAGGATGAGGCACAGCGGCGGCGTAAGGGCAAAGAGGATGAGGGGGAGGAGGCCGCTTCCCCCATGCTGCAGATCCAAAGAGATGCAGCTACGATCATGCAACCGTACTTCACGTCCAACGGCCTGGTCACCAAGGCGCTAGAGCACGCCTTCCAGCTGGAGCACATCATGGACCTAACACGCCTGCGCTGCCTGGGCTCGCTCTTCTCCATGCTGCACCAGGCCTGCCGCAACGTGGCGCAGTATAACGCCAACCATCCCGACTTCCCCATGCAGATCGAGCAGCTGGAGCGCTACATTCAGCGATATCTGGTTTATGCCATACTCTGGTCCCTGTCTGGAGACAGCCGGCTAAAAATGAGAGCAGAGCTGGGTGAATACATCAGAAGAATCACGACCGTGCCTCTGCCCACTGCGCCCAACATACCCATTATCGATTATGAGGTGTCCATCAGCGGAGAATGGTCTCCGTGGCAGGCCAAGGTGCCTCAGATTGAAGTGGAGACGCACAAGGTGGCAGCCCCTGATGTCGTCGTGCCAACGCTGGACACAGTCCGCCACGAAGCCCTCTTGTACACTTGGCTGGCCGAACACAAGCCCCTGGTCTTGTGTGGCCCTCCTGGGTCTGGCAAGACCATGACACTCTTCAGCGCCCTCCGGGCCTTGCCTGACATGGAGGTGGTGGGTCTCAACTTCTCCAGTGCTACTACTCCAGAGCTGCTTCTGAAGACTTTTGATCACTACTGCGAGTACAGGCGCACACCTAATGGGGTGGTTTTGGCTCCTGTTCAACTTGGAAAGTGGCTGGTGTTGTTCTGTGATGAAATCAACTTGCCAGATATGGATAAATATGGGACCCAGAGGGTCATATCCTTCATCAGACAGATGGTGGAGCACGGAGGCTTTTACCGTACCTCAGATCAAACATGGGTGAAGCTGGAGAGAATCCAGTTTGTTGGGGCTTGTAATCCCCCCACAGACCCTGGAAGAAAGCCCCTCTCACACAGGTTCCTGCGCCACGTGCCTGTCGTGTATGTGGATTACCCGGGCCCCGCCTCCCTCACACAGATCTACGGCACCTTCAACCGCGCCATGCTGAGGCTCATTCCATCCCTGCGGACGTATGCAGAGCCGCTCACTGCTGCCATGGTGGAGTTCTACACCATGTCTCAGGAGAGATTCACCCAGGATACACAACCTCACTATATCTATTCACCCCGTGAAATGACTAGGTGGGTGAGAGGCATCTTTGAAGCGCTGAGACCTCTGGAGACCCTGCCTGTTGAAGGCCTCATTCGGATTTGGGCACATGAAGCTCTGCGTCTCTTCCAAGATAGACTCGTAGAGGATGAGGAGAGGCGTTGGACTGATGAGAACATCGACACGGTTGCTCTGAAGCACTTCCCTAACATCGACAGAGAGAAGGCAATGAGCCGACCCATCTTGTACAGCAACTGGCTGTCAAAGGATTACATCCCAGTAGACCAAGAAGAGTTAAGAGATTATGTCAAAGCTAGGCTGAAGGTCTTTTATGAAGAAGAACTTGATGTTCCGCTGGTGCTGTTTAATGAAGTCCTAGACCACGTGCTGAGGATTGACAGAATATTCCGTCAACCTCAAGGCCACTTGCTTCTGATTGGTGTTAGTGGAGCAGGAAAAACTACCCTGTCTCGTTTCGTCGCCTGGATGAACGGTTTGAGTGTGTACCAGATTAAGGTCCATAGGAAGTACACAGGGGAAGACTTTGATGAAGATCTACGGACAGTGTTGAGACGTTCTGGCTGTAAAAATGAAAAGATAGCATTTATAATGGATGAATCTAATGTGTTAGATTCTGGATTCCTGGAGCGAATGAATACCCTTCTGGCCAATGGAGAGGTGCCTGGTCTCTTTGAAGGAGACGAGTATGCCACCTTGATGACGCAGTGCAAAGAGGGGGCACAGAAGGAAGGCCTGATGCTGGACTCGCACGAGGAGCTCTACAAGTGGTTCACTAGCCAGGTTATCCGCAACCTCCACGTCGTGTTCACCATGAACCCGTCCTCGGAGGGACTCAAGGACCGGGCAGCTACATCACCAGCACTTTTCAACAGGTGTGTGTTGAATTGGTTTGGAGACTGGTCCACCGAAGCACTGTATCAGGTTGGCAAAGAATTCACAAGTAAGATGGATCTGGAGAAGCCAAATTACATCGTGCCTGATTACATGCCAGTTGTGTATGATAAGCTGCCGCAGCCACCATCCCATCGGGAAGCCATTGTGAACAGCTGTGTGTTTGTTCATCAGACTCTTCACCAGGCGAATGCTCGGCTAGCAAAGCGAGGCGGCAGAACGATGGCCATCACCCCTCGCCACTACCTGGACTTCATCAATCACTATGCCAACCTGTTCCACGAGAAGCGGAGCGAGCTGGAGGAGCAGCAGATGCACTTGAACGTGGGGCTCAGGAAGATCAAAGAGACAGTCGACCAGGTAGAAGAACTGCGTCGTGACTTGAGGATAAAGAGCCAAGAGCTGGAGGTGAAGAATGCAGCAGCCAATGACAAGCTGAAAAAGATGGTGAAAGACCAGCAGGAGGCTGAAAAGAAGAAGGTTATGAGCCAAGAAATCCAGGAACAGCTGCATAAGCAGCAGGAGGTAATTGCAGACAAACAGATGAGTGTCAAAGAAGATCTTGATAAGGTGGAACCTGCCGTCATTGAGGCCCAGAATGCTGTGAAGTCGATCAAGAAGCAGCACCTGGTGGAGGTGAGGTCCATGGCCAACCCTCCTGCTGCTGTGAAGCTGGCGCTGGAGTCCATCTGCCTGCTGCTGGGGGAAAGCACCACAGACTGGAAGCAGATCCGCTCCATCATCATGCGGGAGAACTTCATCCCCACCATCGTCAACTTCTCTGCAGAGGAGATCAGTGACGCCATAAGGGAGAAGATGAAGAAAAATTACATGTCCAATCCAAGTTACAATTATGAAATTGTGAATCGGGCTTCCCTGGCTTGCGGCCCTATGGTGAAATGGGCAATTGCACAGCTTAACTATGCAGACATGTTAAAGAGAGTGGAGCCCCTACGCAATGAGCTGCAGAAGCTGGAAGATGACGCCAAGGACAACCAGCAGAAGGCCAACGAGGTGGAGCAGATGATCCGAGACCTGGAAGCCAGCATCGCCCGCTACAAGGAGGAATACGCCGTCCTGATCTCAGAGGCCCAGGCCATCAAGGCAGACCTGGCAGCTGTCGAGGCAAAAGTAAACCGGAGCACTGCTCTTCTGAAGAGCTTGTCTGCTGAACGTGAACGATGGGAAAAAACAAGTGAAACTTTCAAAAACCAGATGTCCACCATTGCTGGGGACTGTCTCTTGTCAGCTGCGTTCATTGCCTACGCGGGTTACTTTGACCAGCAGATGCGTCAGAACTTGTTCACTACCTGGTCCCATCACCTACAGCAAGCCAACATCCAGTTCCGTACAGATATTGCCAGGACGGAATACCTTTCCAATGCTGATGAGCGTCTTCGCTGGCAGGCCAGCTCCTTGCCTGCTGATGACCTTTGCACAGAAAATGCCATCATGCTGAAACGATTCAATAGGTATCCGCTGATCATTGACCCCTCTGGACAGGCCACAGAATTCATTATGAATGAATATAAGGATCGTAAGATCACACGGACCAGCTTCCTGGATGACGCCTTCAGAAAGAACTTAGAGAGTGCACTGAGATTCGGTAACCCCCTTCTGGTCCAGGATGTGGAAAGCTACGATCCAGTTTTGAACCCGGTGCTGAACCGTGAAGTGCGGCGAACAGGGGGGAGAGTGCTGATCACTCTCGGGGACCAGGACATAGACCTGTCGCCATCGTTTGTCATCTTCCTGTCCACCCGGGATCCAACTGTCGAGTTCCCACCAGATCTCTGTTCCCGGGTTACTTTTGTAAACTTCACAGTTACCCGTAGCAGTTTACAAAGCCAGTGTCTAAATGAAGTACTTAAAGCAGAAAGACCTGATGTGGACGAGAAACGATCTGATCTTCTTAAACTTCAAGGGGAATTTCAGCTCCGTTTGCGTCAGCTGGAAAAATCTCTACTACAAGCTCTGAACGAGGTGAAAGGGCGCATTTTGGATGACGACACGATCATAACCACTCTGGAGAACCTGAAGAGAGAGGCTGCAGAGGTCACCAGGAAAGTTGAGGAGACGGACATTGTCATGCAGGAGGTGGAGACCGTGTCCCAGCAGTACCTCCCGCTCTCCACCGCCTGCAGCAGCATCTACTTCACCATGGAGTCCCTCAAGCAGATACACTTCTTGTACCAGTACTCCCTCCAGTTTTTCCTGGACATTTATCACAACGTCCTATACGAGAACCCGAACCTGAAGGGTGTCACCGACCACACACAGCGCCTGTCCATTATAACAAAGGACCTCTTCCAGGTGGCGTTTAACCGAGTGGCTCGAGGCATGCTGCATCAGGACCACATTACCTTTGCCATGCTGCTGGCAAGAATCAAACTGAAGGGCACCGTGGGGGAGCCCACCTACGATGCAGAATTCCAGCACTTCTTGAGAGGAAATGAGATTGTCCTGAGTGCTGGCTCCACCCCCAGGATCCAGGGCCTGACTGTGGAGCAGGCGGAGGCGGTGGTGAGGCTGAGCTGCCTTCCCGCGTTTAAGGACTTGATTGCAAAGGTTCAGGCAGACGAGCAATTTGGCATCTGGCTGGACAGCAGCTCCCCGGAGCAGACTGTGCCCTACCTCTGGAGTGAAGAAACACCTGCAACACCCATTGGCCAGGCCATCCACCGCCTGCTCCTGATCCAGGCTTTCCGGCCCGATCGCCTGTTGGCCATGGCCCACATGTTTGTTTCAACAAACCTTGGGGAGTCTTTCATGTCCATCATGGAGCAGCCGCTCGACCTGACCCACATTGTGGGCACAGAGGTGAAGCCCAACACTCCTGTCTTAATGTGCTCTGTGCCTGGTTATGATGCCAGTGGACATGTCGAGGACCTTGCAGCCGAGCAGAACACGCAGATCACTTCAATTGCAATCGGCTCTGCAGAAGGCTTTAACCAAGCAGATAAGGCAATAAACACCGCTGTAAAGTCGGGCAGGTGGGTGATGCTGAAGAATGTGCATCTGGCCCCAGGGTGGCTGATGCAGCTGGAGAAGAAGTTGCATTCCCTGCAGCCGCATGCCTGCTTCCGACTCTTCCTCACCATGGAGATCAACCCCAAGGTGCCTGTGAATCTGCTCCGTGCGGGCCGCATCTTTGTGTTCGAGCCACCGCCAGGGGTGAAGGCCAACATGCTGAGGACGTTCAGCAGCATTCCCGTCTCACGGATATGCAAGTCTCCCAACGAGCGTGCCCGCTTGTACTTCCTGCTGGCCTGGTTTCATGCGATCATCCAAGAACGCTTACGATACGCACCACTGGGGTGGTCAAAGAAGTATGAATTTGGAGAGTCTGACCTGCGGTCAGCTTGCGATACGGTGGACACGTGGCTGGATGACACGGCCAAGGGCAGGCAGAACATCTCACCGGATAAGATCCCGTGGTCTGCACTAAAGACCTTAATGGCCCAGTCCATTTATGGCGGGCGCGTGGACAACGAGTTTGACCAGCGTCTGCTCAACACCTTCCTGGAGCGCCTGTTCACAACCAGGAGTTTCGACAGTGAGTTTAAGCTGGCATGCAAGGTCGACGGACATAAAGACATTCAAATGCCAGATGGCATCAGGCGAGAGGAGTTTGTGCAGTGGGTGGAGTTGCTCCCCGACACCCAGACGCCCTCCTGGCTGGGCCTGCCCAACAACGCCGAGAGAGTCCTCCTTACCACACAGGGTGTGGACATGATCAGTAAAATGCTGAAGATGCAGATGTTGGAGGATGAGGACGACCTGGCCTACGCAGAGACTGAGAAGAAGACGAGGACAGACTCCACGTCCGACGGGCGCCCTGCCTGGATGCGGACACTGCACACCACCGCGTCCAACTGGCTGCACCTCATCCCCCAGACGCTGAGCCACCTCAAGCGCACCGTGGAGAATATCAAGGATCCTTTGTTCAGGTTCTTTGAGAGAGAAGTGAAGATGGGCGCAAAGCTGCTTCAGGACGTTCGCCAGGACCTTGCAGATGTCGTCCAGGTGTGCGAAGGAAAGAAGAAGCAGACCAACTACTTGCGCACGCTGATCAACGAGCTAGTGAAAGGGATCTTGCCTCGGAGCTGGTCCCACTACACGGTGCCTGCCGGCATGACCGTCATCCAGTGGGTGTCCGACTTCAGCGAGAGGATCAAACAGCTGCAGAACATCTCACTGGCAGCTGCATCTGGTGGCGCCAAGGAGCTAAAGAACATCCACGTGTGCCTGGGTGGCCTGTTCGTGCCTGAGGCGTACATCACTGCCACCAGGCAGTATGTGGCCCAGGCCAACAGCTGGTCCCTGGAGGAGCTCTGCCTGGAAGTCAACGTCACCACCTCACAGGGCGCCACCCTTGACGCTTGCAGCTTCGGAGTCACGGGTTTGAAACTTCAAGGGGCCACGTGCAACAACAACAAGCTGTCACTGTCCAATGCCATCTCAACCGCCCTTCCCCTGACGCAGCTGCGCTGGGTCAAGCAGACAAACACCGAGAAGAAGGCCAGTGTGGTAACCTTACCTGTCTACCTGAACTTCACCCGTGCAGACCTCATCTTCACCGTGGACTTCGAAATTGCTACAAAGGAGGATCCTCGCAGCTTCTACGAGCGGGGTGTCGCAGTCTTGTGCACAGAGTAAACTTTTCTAGCTGCCCCTTTCTGTAATAGTGAAAGTTGGTATTTAACATTTATTCATTTTTAAAATATTTGGAAGGTCTGAGCTTGTGAAAAGAAAGTGGTTGGTCTGAGGTTGGAGGAAGCTGAATGGAATCTGACGGTTGGGAGTGGTGGAAATTGGAAGGATACCAGGAGGTATTTGGGAAGGCCAATGGCGTGGCTCCTTTGAGGAAATAAAACACTAAGCATGAGCCGGCTCCGCCTCTTCTGTCTCCGCTTTCA