Transcript asmbl_52538

Sequence
Transcript Sequence for observation asmbl_52538 of TGE0058654:
CCTGGCAGTGGCTGCCTTTAGGGCGGAGCCGGCTCCCGCTCTCCTCAGTCTGCGGTGGGCTAGCGGACGGTCCGGCTTCCGGCGGCCGTTTCTGTCTCTTGCTGGCTGTCTCGCTGAGTCGCGGCCGCCTTCTCATCGCTCCTGGAAGGTCCCGAGCGCGACACCATGTCGGAGCCCGGGGGCGGCGGCGGCGAGGACGGCTCGGCCGGATTGGAAGTGTCGGCCGTGCAGAATGTGGCGGACGTGTCGGTGCTGCAGAAGCACCTGCGCAAGCTGGTGCCGCTGCTGCTGGAGGACGGCGGCGAGGCGCCGGCCGCGCTGGAGGCGGCGCTGGAGGAGAAGAGCGCCCTGGAGCAGATGCGCAAGTTCCTTTCGGACCCGCAGGTCCACACGGTGCTGGTGGAGCGCTCCACGCTCAAAGAGGACGTCGGTGATGAAGGAGAAGAAGAAAAAGAATTCATTTCCTATAACATCAACATAGACATTCATTATGGGGTTAAATCCAATAGCTTGGCATTCATTAAACGTACTCCCGTGATTGATGCAGATAAACCCGTGTCTTCTCAGCTCCGGGTCCTTACACTCAGTGAAGACTCGCCCTACGAAACTTTGCATTCTTTCATTAGCAATGCAGTGGCTCCTTTTTTTAAGTCCTACATTAGAGAGTCTGGCAAGGCAGACAGGGATGGTGATAAAATGGCTCCTTCAGTTGAAAAGAAGATTGCAGAACTCGAAATGGGACTCCTTCACTTGCAGCAAAATATTGAAATTCCGGAGATCAGCCTGCCGATTCATCCAATGATCACAAATGTTGCAAAACAGTGTTATGAGCGTGGAGAAAAGCCAAAAGTTACAGACTTTGGTGATAAGGTTGAAGACCCAACATTTCTTAATCAGTTACAATCTGGAGTTAACCGCTGGATCCGAGAAATTCAAAAAGTGACCAAACTGGATCGAGATCCTGCATCAGGAACTGCCTTACAGGAAATTAGTTTTTGGCTAAACTTGGAACGTGCGTTATACCGCATCCAGGAGAAACGGGAGAGCCCGGAAGTTCTCCTGACTCTGGATATCTTGAAACATGGCAAGCGCTTCCATGCCACCGTCAGTTTTGACACTGACACAGGTCTAAAACAGGCTTTGGAAACTGTGAATGACTACAATCCTCTGATGAAAGATTTCCCTCTGAATGATTTGCTGTCTGCCACGGAGCTGGACAAAATAAGACAGGCGCTTGTTGCCATTTTCACACATTTGAGAAAGATCCGAAACACAAAATATCCTATTCAGAGGGCACTGCGTTTGGTGGAGGCAATTTCAAGAGACTTGAGTTCTCAATTACTCAAAGTATTGGGCACTAGGAAATTGATGCATGTTGCTTATGAAGAATTTGAAAAAGTTATGGTAGCATGCTTTGAAGTTTTTCAGACTTGGGATGATGAGTATGAGAAACTTCAGGTATTGTTGAGAGACATCGTCAAAAGAAAAAGGGAAGAAAATCTGAAGATGGTGTGGCGTATCAACCCTGCCCACAGGAAGCTGCAGGCCCGCCTTGACCAGATGAGAAAATTTAGACGCCAGCATGAACAGCTAAGAGCTGTTATCGTCAGGGTCCTGAGGCCACAGGTCACGGCAGTTGCACAACAGAATCAAGGAGAGGTCCCTGAACCCCAAGATATGAAAGTGGCTGAGGTTCTCTTTGATGCTGCAGATGCAAATGCCATTGAGGAAGTAAACCTTGCTTATGAGAACGTCAAGGAAGTGGATGGACTGGATGTTTCCAAAGAGGGCACGGAAGCCTGGGAGGCTGCTATGAAGAGGTACGATGAGAGGATCGACAGAGTGGAGACCCGGATCACCGCTCGCCTTCGGGATCAGCTTGGCACAGCCAAGAATGCCAACGAGATGTTTAGGATTTTCTCCAGGTTTAATGCACTGTTTGTCAGGCCTCACATCCGTGGGGCCATTCGCGAATACCAGACCCAGCTGATCCAGCGCGTGAAAGATGACATTGAGTCTCTTCACGACAAGTTCAAGGTCCAGTACCCACAGAGTCAGGCTTGTAAGATGAGTCACGTTCGTGACTTGCCCCCTGTGTCAGGGTCTATCATCTGGGCTAAACAGATCGACAGGCAGCTGACGGCCTACATGAAGCGGGTGGAAGATGTCCTTGGCAAGGGCTGGGAGAATCACGTGGAGGGGCAGAAGCTGAAGCAGGATGGAGACAGCTTCCGCATGAAGCTCAACACGCAGGAGATCTTTGATGACTGGGCAAGGAAGGTGCAGCAGCGCAACCTCGGTGTCTCGGGGCGCATTTTCACCATCGAAAGTACTCGGGTTCGGGGCCGAACTGGAAATGTGCTTAAGCTGAAAGTTAACTTTCTTCCTGAGATTATCACACTATCCAAAGAAGTCCGGAACCTCAAATGGCTTGGTTTCCGCGTCCCACTGGCGATTGTGAACAAAGCCCATCAAGCAAACCAGCTTTACCCGTTTGCCATCTCACTGATCGAGAGCGTTCGTACCTATGAACGGACCTGCGAGAAGGTGGAGGAGCGGAACACCATTTCCCTTTTGGTGGCTGGCTTGAAAAAGGAAGTGCAGGCCCTGATCGCAGAAGGCATTGCGTTGGTGTGGGAGTCCTACAAACTTGACCCATATGTACAGCGCTTAGCAGAGACTGTCTTCAACTTCCAAGAAAAGGTGGATGATCTGCTGATCATTGAAGAAAAAATAGACCTAGAAGTCCGTTCCTTGGAAACTTGTATGTATGACCATAAGACATTCTCGGAAATCTTGAACAGAGTCCAGAAAGCAGTGGATGACTTAAATCTGCACTCCTATTCCAATTTGCCCATCTGGGTCAACAAGCTTGACATGGAGATTGAAAGAATATTGGGCGTCCGTCTGCAAGCTGGCCTGAGAGCTTGGACGCAGGTTCTTCTTGGACAAGCTGAAGATAAAGCAGAAGTTGACATGGACACAGATGCTCCACAAGTTAGTCACAAGCCTGGTGGAGAGCCAAAGATCAAAAATGTCGTTCATGAGCTAAGAATAACCAATCAGGTAATCTACTTGAATCCACCAATTGAAGAGTGCAGATACAAGCTGTATCAGGAAATGTTTGCCTGGAAGATGGTTGTACTGTCTCTCCCCAGGATCCAGAGTCAGAGGTACCAGGTGGGTGTACATTACGAATTGACTGAGGAAGAGAAATTCTATCGGAATGCTTTAACACGGATGCCTGATGGCCCTGTTGCCCTGGAAGAGTCGTATTCTGCTGTCATGGGCATTGTATCTGAAGTTGAACAGTATGTCAAGGTTTGGCTTCAGTATCAGTGTTTATGGGATATGCAAGCTGAAAACATCTATAACAGACTTGGAGAAGATCTCAACAAATGGCAGGCTCTCCTGGTCCAAATAAGGAAGGCCAGAGGAACCTTTGACAATGCAGAAACCAAGAAAGAGTTTGGACCAGTAGTTATAGATTATGGCAAGGTACAATCTAAGGTGAACTTGAAATATGACTCTTGGCATAAGGAGGTTCTTAGCAAATTTGGGCAGATGCTAGGATCAAACATGACGGAATTCCATTCCCAGATCTCAAAGTCCCGCCAAGAGTTGGAGCAGCACTCAGTAGACACGGCCAGCACCTCCGATGCAGTGACCTTCATCACCTATGTGCAGTCTTTGAAACGGAAGATCAAGCAGTTTGAGAAGCAAGTTGAGCTCTACCGCAATGGCCAGCGCTTACTGGAAAAGCAAAGGTTCCAGTTCCCACCTTCCTGGCTTTATATTGACAACATCGAGGGAGAGTGGGGAGCCTTCAATGACATCATGCGGCGAAAGGACTCTGCCATTCAGCAGCAGGTGGCAAACCTGCAAATGAAGATTGTCCAGGAGGATCGGGCCGTGGAAAGCCGCACCACCGACCTGCTGACTGACTGGGAGAAGACCAAGCCTGTCACGGGCAACCTTCGCCCAGAAGAGGCACTTCAGGCTCTCACCATATATGAGGGGAAGTTTGGTAGGCTGAAGGACGACAGAGAGAAGTGTGCAAAGGCCAAGGAGGCGCTGGAATTGACAGATACTGGGCTTCTCAGTGGCAGTGAAGAGCGCGTGCAGGTGGCCTTAGAAGAATTACAGGACCTCAAAGGCGTTTGGTCAGAACTTTCTAAGGTTTGGGAGCAAATCGATCAGATGAAGGAGCAACCCTGGGTTTCAGTACAGCCTCGAAAGCTTCGACAAAATTTGGATGCCCTCCTGAACCAGCTGAAAAGCTTCCCTGCCCGGTTGCGACAGTATGCGTCCTATGAGTTTGTTCAGAGGCTTCTGAAAGGTTACATGAAGATAAATATGCTGGTGATTGAACTGAAATCCGAAGCACTTAAAGACCGCCATTGGAAACAGCTCATGAAAAGGCTTCACGTTAATTGGGTTGTTTCTGAGCTAACCCTTGGCCAAATCTGGGATGTTGACTTGCAGAAAAATGAAGCGATTGTCAAGGATGTACTGCTTGTGGCACAAGGGGAGATGGCTTTGGAAGAATTTTTGAAGCAGATAAGAGAAGTGTGGAATACTTATGAACTAGACTTGGTTAATTATCAGAACAAGTGCCGCTTGATCCGTGGCTGGGATGACCTCTTCAACAAGGTCAAAGAACACATCAACAGCGTCTCGGCCATGAAGCTCTCTCCGTATTACAAGGTTTTTGAAGAGGATGCTCTCAGCTGGGAAGATAAGCTGAACAGGATCATGGCTCTCTTTGATGTGTGGATTGATGTGCAGAGGCGGTGGGTCTACCTGGAAGGTATCTTCACAGGCAGTGCAGATATCAAGCACCTGCTGCCAGTGGAAACCCAGCGGTTTCAGAGCATCAGCACTGAGTTTTTGGCTCTAATGAAAAAAGTGTCCAAGTCTCCCCTTGTTATGGATGTTCTGAACATCCAGGGAGTACAGAGGTCTCTGGAAAGATTGGCAGACCTGCTAGGAAAGATCCAGAAAGCATTGGGAGAATATCTGGAAAGAGAGCGGTCATCTTTCCCCAGGTTCTATTTTGTGGGTGATGAAGATTTGCTTGAAATCATTGGAAACAGCAAGAATGTCGCTAAATTACAGAAACACTTCAAGAAGATGTTTGCTGGAGTTTCGAGCATCATCCTGAACGAGGATAACTCTGTTGTTTTGGGTATTTCATCTCGGGAAGGAGAGGAGGTAAATTTATGTTCGTAACTTTTAAAACTTCTCTCACATTTTTGCATACCTCATTTCTTAAAATTGTATTTATTTCAGGTTATGTTTAAAACTCCTGTGTCAATTACTGAACATCCCAAAATCAATGAGTGGCTCACATTGGTAGAAAAGGAGATGAGAGTCACCCTGGCCAAACTGCTTGCTGAGTCTGTTACGGAAGTTGAGATTTTTGGTAAAGCAACTTCAATTGACCCAAATACCTACATCACTTGGATTGATAAATACCAGGCCCAGCTTGTGGTTTTGTCAGCCCAGATAGCCTGGTCTGAGAACGTGGAGACCGCACTGAGCAGCATGGGCGGAGGTGGAGATGCCGCGCCCTTGCACTCTGTGCTGAGCAATGTGGAGGTCACCCTCAATGTGTTAGCAGACTCTGTCCTCATGGAGCAGCCCCCACTCCGAAGGCGGAAGCTAGAACACTTGATTACAGAGTTGGTTCACCAGAGAGATGTTACAAGGTCCTTGATCAAAAGCAAGATTGACAACGCCAAATCTTTTGAATGGCTCAGCCAGATGCGATTTTACTTTGACCCTAAGCAAACTGATGTGTTACAGCAGTTGTCAATTCAAATGGCAAATGCCAAATTTAACTATGGCTTTGAGTACCTGGGTGTTCAGGACAAACTGGTCCAGACCCCCCTCACTGACCGCTGCTATTTGACAATGACACAAGCCTTGGAGGCCAGGCTGGGGGGTTCCCCATTTGGACCTGCTGGAACTGGGAAAACAGAGTCTGTCAAAGCTCTTGGCCATCAGCTTGGACGGTTTGTTTTAGTTTTCAACTGTGATGAAACCTTTGATTTCCAGGCAATGGGCCGGATCTTTGTGGGCCTTTGCCAGGTGGGTGCCTGGGGCTGCTTTGACGAGTTCAACCGCCTGGAGGAGCGGATGCTCTCGGCTGTGTCCCAGCAGGTGCAGTGCATACAGGAAGCACTGCGTGAACATTCCAACCCCAACTACGACAAGACCTCTGCCCCCATTACTTGTGAGCTGCTGAACAAACAAGTCAAGGTGAGCCCGGACATGGCCATCTTCATCACCATGAACCCTGGCTACGCGGGCCGGTCTAACCTTCCTGACAACTTGAAGAAGCTGTTCCGGAGCTTGGCCATGACCAAGCCCGACCGGCAGTTAATCGCCCAGGTCATGCTGTACTCACAGGGTTTCCGCACTGCTGAAGTGCTTGCCAACAAAATCGTCCCGTTTTTTAAACTATGCGATGAGCAGCTCTCTTCCCAAAGCCATTATGACTTCGGTCTTCGGGCTTTGAAGAGTGTGCTGGTGAGTGCAGGCAATGTGAAGAGAGAGAGAATCCAGAAGATAAAGAGGGAGAAAGAGGAACGAGGGGAAGCAGTTGATGAAGGAGAAATTGCTGAAAATCTCCCTGAACAAGAGATTCTGATACAGAGCGTCTGTGAGACGATGGTGCCAAAGCTGGTGGCAGAGGACATCCCGCTGCTCTTCAGCCTCCTGTCGGACGTGTTCCCTGGAGTCCAGTATCACAGGGGTGAGATGACTGCCCTTCGAGAGGAGCTGAAGAAAGTGTGTCAGGAGATGTATTTGACATATGGAGATGGAGAAGAAGTTGGTGGAATGTGGGTTGAAAAGGTTCTCCAGCTCTATCAGATCACCCAGATCAATCATGGCCTGATGATGGTGGGGCCCTCGGGAAGTGGGAAGAGCATGGCCTGGCGTGTCCTGCTGAAGGCATTGGAGAGACTCGAGGGTGTGGAAGGTGTGGCCCATATCATCGACCCCAAGGCCATCAGCAAAGACCACCTCTACGGAACCCTGGACCCCAACACCAGGGAATGGACAGATGGGCTCTTCACACACGTGCTGAGAAAGATCATCGACAGCGTGAGAGGCGAGCTGCAGAAGCGCCAGTGGATCGTCTTCGATGGCGATGTGGATCCAGAGTGGGTTGAGAACTTGAACTCAGTGCTGGATGACAATAAGCTCCTAACTTTGCCCAATGGAGAGCGCCTCAGTCTTCCACCCAATGTGAGAATAATGTTTGAGGTACAGGACTTGAAATACGCGACCTTGGCCACAGTGTCGCGCTGCGGCATGGTCTGGTTCAGTGAGGATGTGCTGAGCACCGACATGATCTTCAACAACTTCCTGGCCAGGCTGCGCAGCATCCCGCTGGATGAAGGGGAGGATGAGGCACAGCGGCGGCGTAAGGGCAAAGAGGATGAGGGGGAGGAGGCCGCTTCCCCCATGCTGCAGATCCAAAGAGATGCAGCTACGATCATGCAACCGTACTTCACGTCCAACGGCCTGGTCACCAAGGCGCTAGAGCACGCCTTCCAGCTGGAGCACATCATGGACCTAACACGCCTGCGCTGCCTGGGCTCGCTCTTCTCCATGCTGCACCAGGCCTGCCGCAACGTGGCGCAGTATAACGCCAACCATCCCGACTTCCCCATGCAGATCGAGCAGCTGGAGCGCTACATTCAGCGATATCTGGTTTATGCCATACTCTGGTCCCTGTCTGGAGACAGCCGGCTAAAAATGAGAGCAGAGCTGGGTGAATACATCAGAAGAATCACGACCGTGCCTCTGCCCACTGCGCCCAACATACCCATTATCGATTATGAGGTGTCCATCAGCGGAGAATGGTCTCCGTGGCAGGCCAAGGTGCCTCAGATTGAAGTGGAGACGCACAAGGTGGCAGCCCCTGATGTCGTCGTGCCAACGCTGGACACAGTCCGCCACGAAGCCCTCTTGTACACTTGGCTGGCCGAACACAAGCCCCTGGTCTTGTGTGGCCCTCCTGGGTCTGGCAAGACCATGACACTCTTCAGCGCCCTCCGGGCCTTGCCTGACATGGAGGTGGTGGGTCTCAACTTCTCCAGTGCTACTACTCCAGAGCTGCTTCTGAAGACTTTTGATCACTACTGCGAGTACAGGCGCACACCTAATGGGGTGGTTTTGGCTCCTGTTCAACTTGGAAAGTGGCTGGTGTTGTTCTGTGATGAAATCAACTTGCCAGATATGGATAAATATGGGACCCAGAGGGTCATATCCTTCATCAGACAGATGGTGGAGCACGGAGGCTTTTACCGTACCTCAGATCAAACATGGGTGAAGCTGGAGAGAATCCAGTTTGTTGGGGCTTGTAATCCCCCCACAGACCCTGGAAGAAAGCCCCTCTCACACAGGTTCCTGCGCCACGTGCCTGTCGTGTATGTGGATTACCCGGGCCCCGCCTCCCTCACACAGATCTACGGCACCTTCAACCGCGCCATGCTGAGGCTCATTCCATCCCTGCGGACGTATGCAGAGCCGCTCACTGCTGCCATGGTGGAGTTCTACACCATGTCTCAGGAGAGATTCACCCAGGATACACAACCTCACTATATCTATTCACCCCGTGAAATGACTAGGTGGGTGAGAGGCATCTTTGAAGCGCTGAGACCTCTGGAGACCCTGCCTGTTGAAGGCCTCATTCGGATTTGGGCACATGAAGCTCTGCGTCTCTTCCAAGATAGACTCGTAGAGGATGAGGAGAGGCGTTGGACTGATGAGAACATCGACACGGTTGCTCTGAAGCACTTCCCTAACATCGACAGAGAGAAGGCAATGAGCCGACCCATCTTGTACAGCAACTGGCTGTCAAAGGATTACATCCCAGTAGACCAAGAAGAGTTAAGAGATTATGTCAAAGCTAGGCTGAAGGTCTTTTATGAAGAAGAACTTGATGTTCCGCTGGTGCTGTTTAATGAAGTCCTAGACCACGTGCTGAGGATTGACAGAATATTCCGTCAACCTCAAGGCCACTTGCTTCTGATTGGTGTTAGTGGAGCAGGAAAAACTACCCTGTCTCGTTTCGTCGCCTGGATGAACGGTTTGAGTGTGTACCAGATTAAGGTCCATAGGAAGTACACAGGGGAAGACTTTGATGAAGATCTACGGACAGTGTTGAGACGTTCTGGCTGTAAAAATGAAAAGATAGCATTTATAATGGATGAATCTAATGTGTTAGATTCTGGATTCCTGGAGCGAATGAATACCCTTCTGGCCAATGGAGAGGTGCCTGGTCTCTTTGAAGGAGACGAGTATGCCACCTTGATGACGCAGTGCAAAGAGGGGGCACAGAAGGAAGGCCTGATGCTGGACTCGCACGAGGAGCTCTACAAGTGGTTCACTAGCCAGGTTATCCGCAACCTCCACGTCGTGTTCACCATGAACCCGTCCTCGGAGGGACTCAAGGACCGGGCAGCTACATCACCAGCACTTTTCAACAGGTGTGTGTTGAATTGGTTTGGAGACTGGTCCACCGAAGCACTGTATCAGGTTGGCAAAGAATTCACAAGTAAGATGGATCTGGAGAAGCCAAATTACATCGTGCCTGATTACATGCCAGTTGTGTATGATAAGCTGCCGCAGCCACCATCCCATCGGGAAGCCATTGTGAACAGCTGTGTGTTTGTTCATCAGACTCTTCACCAGGCGAATGCTCGGCTAGCAAAGCGAGGCGGCAGAACGATGGCCATCACCCCTCGCCACTACCTGGACTTCATCAATCACTATGCCAACCTGTTCCACGAGAAGCGGAGCGAGCTGGAGGAGCAGCAGATGCACTTGAACGTGGGGCTCAGGAAGATCAAAGAGACAGTCGACCAGGTAGAAGAACTGCGTCGTGACTTGAGGATAAAGAGCCAAGAGCTGGAGGTGAAGAATGCAGCAGCCAATGACAAGCTGAAAAAGATGGTGAAAGACCAGCAGGAGGCTGAAAAGAAGAAGGTTATGAGCCAAGAAATCCAGGAACAGCTGCATAAGCAGCAGGAGGTAATTGCAGACAAACAGATGAGTGTCAAAGAAGATCTTGATAAGGTGGAACCTGCCGTCATTGAGGCCCAGAATGCTGTGAAGTCGATCAAGAAGCAGCACCTGGTGGAGGTGAGGTCCATGGCCAACCCTCCTGCTGCTGTGAAGCTGGCGCTGGAGTCCATCTGCCTGCTGCTGGGGGAAAGCACCACAGACTGGAAGCAGATCCGCTCCATCATCATGCGGGAGAACTTCATCCCCACCATCGTCAACTTCTCTGCAGAGGAGATCAGTGACGCCATAAGGGAGAAGATGAAGAAAAATTACATGTCCAATCCAAGTTACAATTATGAAATTGTGAATCGGGCTTCCCTGGCTTGCGGCCCTATGGTGAAATGGGCAATTGCACAGCTTAACTATGCAGACATGTTAAAGAGAGTGGAGCCCCTACGCAATGAGCTGCAGAAGCTGGAAGATGACGCCAAGGACAACCAGCAGAAGGCCAACGAGGTGGAGCAGATGATCCGAGACCTGGAAGCCAGCATCGCCCGCTACAAGGAGGAATACGCCGTCCTGATCTCAGAGGCCCAGGCCATCAAGGCAGACCTGGCAGCTGTCGAGGCAAAAGTAAACCGGAGCACTGCTCTTCTGAAGAGCTTGTCTGCTGAACGTGAACGATGGGAAAAAACAAGTGAAACTTTCAAAAACCAGATGTCCACCATTGCTGGGGACTGTCTCTTGTCAGCTGCGTTCATTGCCTACGCGGGTTACTTTGACCAGCAGATGCGTCAGAACTTGTTCACTACCTGGTCCCATCACCTACAGCAAGCCAACATCCAGTTCCGTACAGATATTGCCAGGACGGAATACCTTTCCAATGCTGATGAGCGTCTTCGCTGGCAGGCCAGCTCCTTGCCTGCTGATGACCTTTGCACAGAAAATGCCATCATGCTGAAACGATTCAATAGGTATCCGCTGATCATTGACCCCTCTGGACAGGCCACAGAATTCATTATGAATGAATATAAGGATCGTAAGATCACACGGACCAGCTTCCTGGATGACGCCTTCAGAAAGAACTTAGAGAGTGCACTGAGATTCGGTAACCCCCTTCTGGTCCAGGATGTGGAAAGCTACGATCCAGTTTTGAACCCGGTGCTGAACCGTGAAGTGCGGCGAACAGGGGGGAGAGTGCTGATCACTCTCGGGGACCAGGACATAGACCTGTCGCCATCGTTTGTCATCTTCCTGTCCACCCGGGATCCAACTGTCGAGTTCCCACCAGATCTCTGTTCCCGGGTTACTTTTGTAAACTTCACAGTTACCCGTAGCAGTTTACAAAGCCAGTGTCTAAATGAAGTACTTAAAGCAGAAAGACCTGATGTGGACGAGAAACGATCTGATCTTCTTAAACTTCAAGGGGAATTTCAGCTCCGTTTGCGTCAGCTGGAAAAATCTCTACTACAAGCTCTGAACGAGGTGAAAGGGCGCATTTTGGATGACGACACGATCATAACCACTCTGGAGAACCTGAAGAGAGAGGCTGCAGAGGTCACCAGGAAAGTTGAGGAGACGGACATTGTCATGCAGGAGGTGGAGACCGTGTCCCAGCAGTACCTCCCGCTCTCCACCGCCTGCAGCAGCATCTACTTCACCATGGAGTCCCTCAAGCAGATACACTTCTTGTACCAGTACTCCCTCCAGTTTTTCCTGGACATTTATCACAACGTCCTATACGAGAACCCGAACCTGAAGGGTGTCACCGACCACACACAGCGCCTGTCCATTATAACAAAGGACCTCTTCCAGGTGGCGTTTAACCGAGTGGCTCGAGGCATGCTGCATCAGGACCACATTACCTTTGCCATGCTGCTGGCAAGAATCAAACTGAAGGGCACCGTGGGGGAGCCCACCTACGATGCAGAATTCCAGCACTTCTTGAGAGGAAATGAGATTGTCCTGAGTGCTGGCTCCACCCCCAGGATCCAGGGCCTGACTGTGGAGCAGGCGGAGGCGGTGGTGAGGCTGAGCTGCCTTCCCGCGTTTAAGGACTTGATTGCAAAGGTTCAGGCAGACGAGCAATTTGGCATCTGGCTGGACAGCAGCTCCCCGGAGCAGACTGTGCCCTACCTCTGGAGTGAAGAAACACCTGCAACACCCATTGGCCAGGCCATCCACCGCCTGCTCCTGATCCAGGCTTTCCGGCCCGATCGCCTGTTGGCCATGGCCCACATGTTTGTTTCAACAAACCTTGGGGAGTCTTTCATGTCCATCATGGAGCAGCCGCTCGACCTGACCCACATTGTGGGCACAGAGGTGAAGCCCAACACTCCTGTCTTAATGTGCTCTGTGCCTGGTTATGATGCCAGTGGACATGTCGAGGACCTTGCAGCCGAGCAGAACACGCAGATCACTTCAATTGCAATCGGCTCTGCAGAAGGCTTTAACCAAGCAGATAAGGCAATAAACACCGCTGTAAAGTCGGGCAGGTGGGTGATGCTGAAGAATGTGCATCTGGCCCCAGGGTGGCTGATGCAGCTGGAGAAGAAGTTGCATTCCCTGCAGCCGCATGCCTGCTTCCGACTCTTCCTCACCATGGAGATCAACCCCAAGGTGCCTGTGAATCTGCTCCGTGCGGGCCGCATCTTTGTGTTCGAGCCACCGCCAGGGGTGAAGGCCAACATGCTGAGGACGTTCAGCAGCATTCCCGTCTCACGGATATGCAAGTCTCCCAACGAGCGTGCCCGCTTGTACTTCCTGCTGGCCTGGTTTCATGCGATCATCCAAGAACGCTTACGATACGCACCACTGGGGTGGTCAAAGAAGTATGAATTTGGAGAGTCTGACCTGCGGTCAGCTTGCGATACGGTGGACACGTGGCTGGATGACACGGCCAAGGGCAGGCAGAACATCTCACCGGATAAGATCCCGTGGTCTGCACTAAAGACCTTAATGGCCCAGTCCATTTATGGCGGGCGCGTGGACAACGAGTTTGACCAGCGTCTGCTCAACACCTTCCTGGAGCGCCTGTTCACAACCAGGAGTTTCGACAGTGAGTTTAAGCTGGCATGCAAGGTCGACGGACATAAAGACATTCAAATGCCAGATGGCATCAGGCGAGAGGAGTTTGTGCAGTGGGTGGAGTTGCTCCCCGACACCCAGACGCCCTCCTGGCTGGGCCTGCCCAACAACGCCGAGAGAGTCCTCCTTACCACACAGGGTGTGGACATGATCAGTAAAATGCTGAAGATGCAGATGTTGGAGGATGAGGACGACCTGGCCTACGCAGAGACTGAGAAGAAGACGAGGACAGACTCCACGTCCGACGGGCGCCCTGCCTGGATGCGGACACTGCACACCACCGCGTCCAACTGGCTGCACCTCATCCCCCAGACGCTGAGCCACCTCAAGCGCACCGTGGAGAATATCAAGGATCCTTTGTTCAGGTTCTTTGAGAGAGAAGTGAAGATGGGCGCAAAGCTGCTTCAGGACGTTCGCCAGGACCTTGCAGATGTCGTCCAGGTGTGCGAAGGAAAGAAGAAGCAGACCAACTACTTGCGCACGCTGATCAACGAGCTAGTGAAAGGGATCTTGCCTCGGAGCTGGTCCCACTACACGGTGCCTGCCGGCATGACCGTCATCCAGTGGGTGTCCGACTTCAGCGAGAGGATCAAACAGCTGCAGAACATCTCACTGGCAGCTGCATCTGGTGGCGCCAAGGAGCTAAAGAACATCCACGTGTGCCTGGGTGGCCTGTTCGTGCCTGAGGCGTACATCACTGCCACCAGGCAGTATGTGGCCCAGGCCAACAGCTGGTCCCTGGAGGAGCTCTGCCTGGAAGTCAACGTCACCACCTCACAGGGCGCCACCCTTGACGCTTGCAGCTTCGGAGTCACGGGTTTGAAACTTCAAGGGGCCACGTGCAACAACAACAAGCTGTCACTGTCCAATGCCATCTCAACCGCCCTTCCCCTGACGCAGCTGCGCTGGGTCAAGCAGACAAACACCGAGAAGAAGGCCAGTGTGGTAACCTTACCTGTCTACCTGAACTTCACCCGTGCAGACCTCATCTTCACCGTGGACTTCGAAATTGCTACAAAGGAGGATCCTCGCAGCTTCTACGAGCGGGGTGTCGCAGTCTTGTGCACAGAGTAAACTTTTCTAGCTGCCCCTTTCTGTAATAGTGAAAGTTGGTATTTAACATTTATTCATTTTTAAAATATTTGGAAGGTCTGAGCTTGTGAAAAGAAAGTGGTTGGTCTGAGGTTGGAGGAAGCTGAATGGAATCTGACGGTTGGGAGTGGTGGAAATTGGAAGGATACCAGGAGGTATTTGGGAAGGCCAATGGCGTGGCTCCTTTGAGGAAATAAAACACTAAGCATGAGCCGGCTCCGCCTCTTCTGTCTCCGCTTTCA