Transcript asmbl_52537

Sequence
Transcript Sequence for observation asmbl_52537 of TGE0056529:
CCTGGCAGTGGCTGCCTTTAGGGCGGAGCCGGCTCCCGCTCTCCTCAGTCTGCGGTGGGCTAGCGGACGGTCCGGCTTCCGGCGGCCGTTTCTGTCTCTTGCTGGCTGTCTCGCTGAGTCGCGGCCGCCTTCTCATCGCTCCTGGAAGGTCCCGAGCGCGACACCATGTCGGAGCCCGGGGGCGGCGGCGGCGAGGACGGCTCGGCCGGATTGGAAGTGTCGGCCGTGCAGAATGTGGCGGACGTGTCGGTGCTGCAGAAGCACCTGCGCAAGCTGGTGCCGCTGCTGCTGGAGGACGGCGGCGAGGCGCCGGCCGCGCTGGAGGCGGCGCTGGAGGAGAAGAGCGCCCTGGAGCAGATGCGCAAGTTCCTTTCGGACCCGCAGGTCCACACGGTGCTGGTGGAGCGCTCCACGCTCAAAGAGGACGTCGGTGATGAAGGAGAAGAAGAAAAAGAATTCATTTCCTATAACATCAACATAGACATTCATTATGGGGTTAAATCCAATAGCTTGGCATTCATTAAACGTACTCCCGTGATTGATGCAGATAAACCCGTGTCTTCTCAGCTCCGGGTCCTTACACTCAGTGAAGACTCGCCCTACGAAACTTTGCATTCTTTCATTAGCAATGCAGTGGCTCCTTTTTTTAAGTCCTACATTAGAGAGTCTGGCAAGGCAGACAGGGATGGTGATAAAATGGCTCCTTCAGTTGAAAAGAAGATTGCAGAACTCGAAATGGGACTCCTTCACTTGCAGCAAAATATTGAAATTCCGGAGATCAGCCTGCCGATTCATCCAATGATCACAAATGTTGCAAAACAGTGTTATGAGCGTGGAGAAAAGCCAAAAGTTACAGACTTTGGTGATAAGGTTGAAGACCCAACATTTCTTAATCAGTTACAATCTGGAGTTAACCGCTGGATCCGAGAAATTCAAAAAGTGACCAAACTGGATCGAGATCCTGCATCAGGAACTGCCTTACAGGAAATTAGTTTTTGGCTAAACTTGGAACGTGCGTTATACCGCATCCAGGAGAAACGGGAGAGCCCGGAAGTTCTCCTGACTCTGGATATCTTGAAACATGGCAAGCGCTTCCATGCCACCGTCAGTTTTGACACTGACACAGGTCTAAAACAGGCTTTGGAAACTGTGAATGACTACAATCCTCTGATGAAAGATTTCCCTCTGAATGATTTGCTGTCTGCCACGGAGCTGGACAAAATAAGACAGGCGCTTGTTGCCATTTTCACACATTTGAGAAAGATCCGAAACACAAAATATCCTATTCAGAGGGCACTGCGTTTGGTGGAGGCAATTTCAAGAGACTTGAGTTCTCAATTACTCAAAGTATTGGGCACTAGGAAATTGATGCATGTTGCTTATGAAGAATTTGAAAAAGTTATGGTAGCATGCTTTGAAGTTTTTCAGACTTGGGATGATGAGTATGAGAAACTTCAGGTATTGTTGAGAGACATCGTCAAAAGAAAAAGGGAAGAAAATCTGAAGATGGTGTGGCGTATCAACCCTGCCCACAGGAAGCTGCAGGCCCGCCTTGACCAGATGAGAAAATTTAGACGCCAGCATGAACAGCTAAGAGCTGTTATCGTCAGGGTCCTGAGGCCACAGGTCACGGCAGTTGCACAACAGAATCAAGGAGAGGTCCCTGAACCCCAAGATATGAAAGTGGCTGAGGTTCTCTTTGATGCTGCAGATGCAAATGCCATTGAGGAAGTAAACCTTGCTTATGAGAACGTCAAGGAAGTGGATGGACTGGATGTTTCCAAAGAGGGCACGGAAGCCTGGGAGGCTGCTATGAAGAGGTACGATGAGAGGATCGACAGAGTGGAGACCCGGATCACCGCTCGCCTTCGGGATCAGCTTGGCACAGCCAAGAATGCCAACGAGATGTTTAGGATTTTCTCCAGGTTTAATGCACTGTTTGTCAGGCCTCACATCCGTGGGGCCATTCGCGAATACCAGACCCAGCTGATCCAGCGCGTGAAAGATGACATTGAGTCTCTTCACGACAAGTTCAAGGTCCAGTACCCACAGAGTCAGGCTTGTAAGATGAGTCACGTTCGTGACTTGCCCCCTGTGTCAGGGTCTATCATCTGGGCTAAACAGATCGACAGGCAGCTGACGGCCTACATGAAGCGGGTGGAAGATGTCCTTGGCAAGGGCTGGGAGAATCACGTGGAGGGGCAGAAGCTGAAGCAGGATGGAGACAGCTTCCGCATGAAGCTCAACACGCAGGAGATCTTTGATGACTGGGCAAGGAAGGTGCAGCAGCGCAACCTCGGTGTCTCGGGGCGCATTTTCACCATCGAAAGTACTCGGGTTCGGGGCCGAACTGGAAATGTGCTTAAGCTGAAAGTTAACTTTCTTCCTGAGATTATCACACTATCCAAAGAAGTCCGGAACCTCAAATGGCTTGGTTTCCGCGTCCCACTGGCGATTGTGAACAAAGCCCATCAAGCAAACCAGCTTTACCCGTTTGCCATCTCACTGATCGAGAGCGTTCGTACCTATGAACGGACCTGCGAGAAGGTGGAGGAGCGGAACACCATTTCCCTTTTGGTGGCTGGCTTGAAAAAGGAAGTGCAGGCCCTGATCGCAGAAGGCATTGCGTTGGTGTGGGAGTCCTACAAACTTGACCCATATGTACAGCGCTTAGCAGAGACTGTCTTCAACTTCCAAGAAAAGGTGGATGATCTGCTGATCATTGAAGAAAAAATAGACCTAGAAGTCCGTTCCTTGGAAACTTGTATGTATGACCATAAGACATTCTCGGAAATCTTGAACAGAGTCCAGAAAGCAGTGGATGACTTAAATCTGCACTCCTATTCCAATTTGCCCATCTGGGTCAACAAGCTTGACATGGAGATTGAAAGAATATTGGGCGTCCGTCTGCAAGCTGGCCTGAGAGCTTGGACGCAGGTTCTTCTTGGACAAGCTGAAGATAAAGCAGAAGTTGACATGGACACAGATGCTCCACAAGTTAGTCACAAGCCTGGTGGAGAGCCAAAGATCAAAAATGTCGTTCATGAGCTAAGAATAACCAATCAGGTAATCTACTTGAATCCACCAATTGAAGAGTGCAGATACAAGCTGTATCAGGAAATGTTTGCCTGGAAGATGGTTGTACTGTCTCTCCCCAGGATCCAGAGTCAGAGGTACCAGGTGGGTGTACATTACGAATTGACTGAGGAAGAGAAATTCTATCGGAATGCTTTAACACGGATGCCTGATGGCCCTGTTGCCCTGGAAGAGTCGTATTCTGCTGTCATGGGCATTGTATCTGAAGTTGAACAGTATGTCAAGGTTTGGCTTCAGTATCAGTGTTTATGGGATATGCAAGCTGAAAACATCTATAACAGACTTGGAGAAGATCTCAACAAATGGCAGGCTCTCCTGGTCCAAATAAGGAAGGCCAGAGGAACCTTTGACAATGCAGAAACCAAGAAAGAGTTTGGACCAGTAGTTATAGATTATGGCAAGGTACAATCTAAGGTGAACTTGAAATATGACTCTTGGCATAAGGAGGTTCTTAGCAAATTTGGGCAGATGCTAGGATCAAACATGACGGAATTCCATTCCCAGATCTCAAAGTCCCGCCAAGAGTTGGAGCAGCACTCAGTAGACACGGCCAGCACCTCCGATGCAGTGACCTTCATCACCTATGTGCAGTCTTTGAAACGGAAGATCAAGCAGTTTGAGAAGCAAGTTGAGCTCTACCGCAATGGCCAGCGCTTACTGGAAAAGCAAAGGTTCCAGTTCCCACCTTCCTGGCTTTATATTGACAACATCGAGGGAGAGTGGGGAGCCTTCAATGACATCATGCGGCGAAAGGACTCTGCCATTCAGCAGCAGGTGGCAAACCTGCAAATGAAGATTGTCCAGGAGGATCGGGCCGTGGAAAGCCGCACCACCGACCTGCTGACTGACTGGGAGAAGACCAAGCCTGTCACGGGCAACCTTCGCCCAGAAGAGGCACTTCAGGCTCTCACCATATATGAGGGGAAGTTTGGTAGGCTGAAGGACGACAGAGAGAAGTGTGCAAAGGCCAAGGAGGCGCTGGAATTGACAGATACTGGGCTTCTCAGTGGCAGTGAAGAGCGCGTGCAGGTGGCCTTAGAAGAATTACAGGACCTCAAAGGCGTTTGGTCAGAACTTTCTAAGGTTTGGGAGCAAATCGATCAGATGAAGGAGCAACCCTGGGTTTCAGTACAGCCTCGAAAGCTTCGACAAAATTTGGATGCCCTCCTGAACCAGCTGAAAAGCTTCCCTGCCCGGTTGCGACAGTATGCGTCCTATGAGTTTGTTCAGAGGCTTCTGAAAGGTTACATGAAGATAAATATGCTGGTGATTGAACTGAAATCCGAAGCACTTAAAGACCGCCATTGGAAACAGCTCATGAAAAGGCTTCACGTTAATTGGGTTGTTTCTGAGCTAACCCTTGGCCAAATCTGGGATGTTGACTTGCAGAAAAATGAAGCGATTGTCAAGGATGTACTGCTTGTGGCACAAGGGGAGATGGCTTTGGAAGAATTTTTGAAGCAGATAAGAGAAGTGTGGAATACTTATGAACTAGACTTGGTTAATTATCAGAACAAGTGCCGCTTGATCCGTGGCTGGGATGACCTCTTCAACAAGGTCAAAGAACACATCAACAGCGTCTCGGCCATGAAGCTCTCTCCGTATTACAAGGTTTTTGAAGAGGATGCTCTCAGCTGGGAAGATAAGCTGAACAGGATCATGGCTCTCTTTGATGTGTGGATTGATGTGCAGAGGCGGTGGGTCTACCTGGAAGGTATCTTCACAGGCAGTGCAGATATCAAGCACCTGCTGCCAGTGGAAACCCAGCGGTTTCAGAGCATCAGCACTGAGTTTTTGGCTCTAATGAAAAAAGTGTCCAAGTCTCCCCTTGTTATGGATGTTCTGAACATCCAGGGAGTACAGAGGTCTCTGGAAAGATTGGCAGACCTGCTAGGAAAGATCCAGAAAGCATTGGGAGAATATCTGGAAAGAGAGCGGTCATCTTTCCCCAGGTTCTATTTTGTGGGTGATGAAGATTTGCTTGAAATCATTGGAAACAGCAAGAATGTCGCTAAATTACAGAAACACTTCAAGAAGATGTTTGCTGGAGTTTCGAGCATCATCCTGAACGAGGATAACTCTGTTGTTTTGGGTATTTCATCTCGGGAAGGAGAGGAGGTTATGTTTAAAACTCCTGTGTCAATTACTGAACATCCCAAAATCAATGAGTGGCTCACATTGGTAGAAAAGGAGATGAGAGTCACCCTGGCCAAACTGCTTGCTGAGTCTGTTACGGAAGTTGAGATTTTTGGTAAAGCAACTTCAATTGACCCAAATACCTACATCACTTGGATTGATAAATACCAGGCCCAGCTTGTGGTTTTGTCAGCCCAGATAGCCTGGTCTGAGAACGTGGAGACCGCACTGAGCAGCATGGGCGGAGGTGGAGATGCCGCGCCCTTGCACTCTGTGCTGAGCAATGTGGAGGTCACCCTCAATGTGTTAGCAGACTCTGTCCTCATGGAGCAGCCCCCACTCCGAAGGCGGAAGCTAGAACACTTGATTACAGAGTTGGTTCACCAGAGAGATGTTACAAGGTCCTTGATCAAAAGCAAGATTGACAACGCCAAATCTTTTGAATGGCTCAGCCAGATGCGATTTTACTTTGACCCTAAGCAAACTGATGTGTTACAGCAGTTGTCAATTCAAATGGCAAATGCCAAATTTAACTATGGCTTTGAGTACCTGGGTGTTCAGGACAAACTGGTCCAGACCCCCCTCACTGACCGCTGCTATTTGACAATGACACAAGCCTTGGAGGCCAGGCTGGGGGGTTCCCCATTTGGACCTGCTGGAACTGGGAAAACAGAGTCTGTCAAAGCTCTTGGCCATCAGCTTGGACGGTTTGTTTTAGTTTTCAACTGTGATGAAACCTTTGATTTCCAGGCAATGGGCCGGATCTTTGTGGGCCTTTGCCAGGTGGGTGCCTGGGGCTGCTTTGACGAGTTCAACCGCCTGGAGGAGCGGATGCTCTCGGCTGTGTCCCAGCAGGTGCAGTGCATACAGGAAGCACTGCGTGAACATTCCAACCCCAACTACGACAAGACCTCTGCCCCCATTACTTGTGAGCTGCTGAACAAACAAGTCAAGGTGAGCCCGGACATGGCCATCTTCATCACCATGAACCCTGGCTACGCGGGCCGGTCTAACCTTCCTGACAACTTGAAGAAGCTGTTCCGGAGCTTGGCCATGACCAAGCCCGACCGGCAGTTAATCGCCCAGGTCATGCTGTACTCACAGGGTTTCCGCACTGCTGAAGTGCTTGCCAACAAAATCGTCCCGTTTTTTAAACTATGCGATGAGCAGCTCTCTTCCCAAAGCCATTATGACTTCGGTCTTCGGGCTTTGAAGAGTGTGCTGGTGAGTGCAGGCAATGTGAAGAGAGAGAGAATCCAGAAGATAAAGAGGGAGAAAGAGGAACGAGGGGAAGCAGTTGATGAAGGAGAAATTGCTGAAAATCTCCCTGAACAAGAGATTCTGATACAGAGCGTCTGTGAGACGATGGTGCCAAAGCTGGTGGCAGAGGACATCCCGCTGCTCTTCAGCCTCCTGTCGGACGTGTTCCCTGGAGTCCAGTATCACAGGGGTGAGATGACTGCCCTTCGAGAGGAGCTGAAGAAAGTGTGTCAGGAGATGTATTTGACATATGGAGATGGAGAAGAAGTTGGTGGAATGTGGGTTGAAAAGGTTCTCCAGCTCTATCAGATCACCCAGATCAATCATGGCCTGATGATGGTGGGGCCCTCGGGAAGTGGGAAGAGCATGGCCTGGCGTGTCCTGCTGAAGGCATTGGAGAGACTCGAGGGTGTGGAAGGTGTGGCCCATATCATCGACCCCAAGGCCATCAGCAAAGACCACCTCTACGGAACCCTGGACCCCAACACCAGGGAATGGACAGATGGGCTCTTCACACACGTGCTGAGAAAGATCATCGACAGCGTGAGAGGCGAGCTGCAGAAGCGCCAGTGGATCGTCTTCGATGGCGATGTGGATCCAGAGTGGGTTGAGAACTTGAACTCAGTGCTGGATGACAATAAGCTCCTAACTTTGCCCAATGGAGAGCGCCTCAGTCTTCCACCCAATGTGAGAATAATGTTTGAGGTACAGGACTTGAAATACGCGACCTTGGCCACAGTGTCGCGCTGCGGCATGGTCTGGTTCAGTGAGGATGTGCTGAGCACCGACATGATCTTCAACAACTTCCTGGCCAGGCTGCGCAGCATCCCGCTGGATGAAGGGGAGGATGAGGCACAGCGGCGGCGTAAGGGCAAAGAGGATGAGGGGGAGGAGGCCGCTTCCCCCATGCTGCAGATCCAAAGAGATGCAGCTACGATCATGCAACCGTACTTCACGTCCAACGGCCTGGTCACCAAGGCGCTAGAGCACGCCTTCCAGCTGGAGCACATCATGGACCTAACACGCCTGCGCTGCCTGGGCTCGCTCTTCTCCATGCTGCACCAGGCCTGCCGCAACGTGGCGCAGTATAACGCCAACCATCCCGACTTCCCCATGCAGATCGAGCAGCTGGAGCGCTACATTCAGCGATATCTGGTTTATGCCATACTCTGGTCCCTGTCTGGAGACAGCCGGCTAAAAATGAGAGCAGAGCTGGGTGAATACATCAGAAGAATCACGACCGTGCCTCTGCCCACTGCGCCCAACATACCCATTATCGATTATGAGGTGTCCATCAGCGGAGAATGGTCTCCGTGGCAGGCCAAGGTGCCTCAGATTGAAGTGGAGACGCACAAGGTGGCAGCCCCTGATGTCGTCGTGCCAACGCTGGACACAGTCCGCCACGAAGCCCTCTTGTACACTTGGCTGGCCGAACACAAGCCCCTGGTCTTGTGTGGCCCTCCTGGGTCTGGCAAGACCATGACACTCTTCAGCGCCCTCCGGGCCTTGCCTGACATGGAGGTGGTGGGTCTCAACTTCTCCAGTGCTACTACTCCAGAGCTGCTTCTGAAGACTTTTGATCACTACTGCGAGTACAGGCGCACACCTAATGGGGTGGTTTTGGCTCCTGTTCAACTTGGAAAGTGGCTGGTGTTGTTCTGTGATGAAATCAACTTGCCAGATATGGATAAATATGGGACCCAGAGGGTCATATCCTTCATCAGACAGATGGTGGAGCACGGAGGCTTTTACCGTACCTCAGATCAAACATGGGTGAAGCTGGAGAGAATCCAGTTTGTTGGGGCTTGTAATCCCCCCACAGACCCTGGAAGAAAGCCCCTCTCACACAGGTTCCTGCGCCACGTGCCTGTCGTGTATGTGGATTACCCGGGCCCCGCCTCCCTCACACAGATCTACGGCACCTTCAACCGCGCCATGCTGAGGCTCATTCCATCCCTGCGGACGTATGCAGAGCCGCTCACTGCTGCCATGGTGGAGTTCTACACCATGTCTCAGGAGAGATTCACCCAGGATACACAACCTCACTATATCTATTCACCCCGTGAAATGACTAGGTGGGTGAGAGGCATCTTTGAAGCGCTGAGACCTCTGGAGACCCTGCCTGTTGAAGGCCTCATTCGGATTTGGGCACATGAAGCTCTGCGTCTCTTCCAAGATAGACTCGTAGAGGATGAGGAGAGGCGTTGGACTGATGAGAACATCGACACGGTTGCTCTGAAGCACTTCCCTAACATCGACAGAGAGAAGGCAATGAGCCGACCCATCTTGTACAGCAACTGGCTGTCAAAGGATTACATCCCAGTAGACCAAGAAGAGTTAAGAGATTATGTCAAAGCTAGGCTGAAGGTCTTTTATGAAGAAGAACTTGATGTTCCGCTGGTGCTGTTTAATGAAGTCCTAGACCACGTGCTGAGGATTGACAGAATATTCCGTCAACCTCAAGGCCACTTGCTTCTGATTGGTGTTAGTGGAGCAGGAAAAACTACCCTGTCTCGTTTCGTCGCCTGGATGAACGGTTTGAGTGTGTACCAGATTAAGGTCCATAGGAAGTACACAGGGGAAGACTTTGATGAAGATCTACGGACAGTGTTGAGACGTTCTGGCTGTAAAAATGAAAAGATAGCATTTATAATGGATGAATCTAATGTGTTAGATTCTGGATTCCTGGAGCGAATGAATACCCTTCTGGCCAATGGAGAGGTGCCTGGTCTCTTTGAAGGAGACGAGTATGCCACCTTGATGACGCAGTGCAAAGAGGGGGCACAGAAGGAAGGCCTGATGCTGGACTCGCACGAGGAGCTCTACAAGTGGTTCACTAGCCAGGTTATCCGCAACCTCCACGTCGTGTTCACCATGAACCCGTCCTCGGAGGGACTCAAGGACCGGGCAGCTACATCACCAGCACTTTTCAACAGGTGTGTGTTGAATTGGTTTGGAGACTGGTCCACCGAAGCACTGTATCAGGTTGGCAAAGAATTCACAAGTAAGATGGATCTGGAGAAGCCAAATTACATCGTGCCTGATTACATGCCAGTTGTGTATGATAAGCTGCCGCAGCCACCATCCCATCGGGAAGCCATTGTGAACAGCTGTGTGTTTGTTCATCAGACTCTTCACCAGGCGAATGCTCGGCTAGCAAAGCGAGGCGGCAGAACGATGGCCATCACCCCTCGCCACTACCTGGACTTCATCAATCACTATGCCAACCTGTTCCACGAGAAGCGGAGCGAGCTGGAGGAGCAGCAGATGCACTTGAACGTGGGGCTCAGGAAGATCAAAGAGACAGTCGACCAGGTAGAAGAACTGCGTCGTGACTTGAGGATAAAGAGCCAAGAGCTGGAGGTGAAGAATGCAGCAGCCAATGACAAGCTGAAAAAGATGGTGAAAGACCAGCAGGAGGCTGAAAAGAAGAAGGTTATGAGCCAAGAAATCCAGGAACAGCTGCATAAGCAGCAGGAGGTAATTGCAGACAAACAGATGAGTGTCAAAGAAGATCTTGATAAGGTGGAACCTGCCGTCATTGAGGCCCAGAATGCTGTGAAGTCGATCAAGAAGCAGCACCTGGTGGAGGTGAGGTCCATGGCCAACCCTCCTGCTGCTGTGAAGCTGGCGCTGGAGTCCATCTGCCTGCTGCTGGGGGAAAGCACCACAGACTGGAAGCAGATCCGCTCCATCATCATGCGGGAGAACTTCATCCCCACCATCGTCAACTTCTCTGCAGAGGAGATCAGTGACGCCATAAGGGAGAAGATGAAGAAAAATTACATGTCCAATCCAAGTTACAATTATGAAATTGTGAATCGGGCTTCCCTGGCTTGCGGCCCTATGGTGAAATGGGCAATTGCACAGCTTAACTATGCAGACATGTTAAAGAGAGTGGAGCCCCTACGCAATGAGCTGCAGAAGCTGGAAGATGACGCCAAGGACAACCAGCAGAAGGCCAACGAGGTGGAGCAGATGATCCGAGACCTGGAAGCCAGCATCGCCCGCTACAAGGAGGAATACGCCGTCCTGATCTCAGAGGCCCAGGCCATCAAGGCAGACCTGGCAGCTGTCGAGGCAAAAGTAAACCGGAGCACTGCTCTTCTGAAGAGCTTGTCTGCTGAACGTGAACGATGGGAAAAAACAAGTGAAACTTTCAAAAACCAGATGTCCACCATTGCTGGGGACTGTCTCTTGTCAGCTGCGTTCATTGCCTACGCGGGTTACTTTGACCAGCAGATGCGTCAGAACTTGTTCACTACCTGGTCCCATCACCTACAGCAAGCCAACATCCAGTTCCGTACAGATATTGCCAGGACGGAATACCTTTCCAATGCTGATGAGCGTCTTCGCTGGCAGGCCAGCTCCTTGCCTGCTGATGACCTTTGCACAGAAAATGCCATCATGCTGAAACGATTCAATAGGTATCCGCTGATCATTGACCCCTCTGGACAGGCCACAGAATTCATTATGAATGAATATAAGGATCGTAAGATCACACGGACCAGCTTCCTGGATGACGCCTTCAGAAAGAACTTAGAGAGTGCACTGAGATTCGGTAACCCCCTTCTGGTCCAGGATGTGGAAAGCTACGATCCAGTTTTGAACCCGGTGCTGAACCGTGAAGTGCGGCGAACAGGGGGGAGAGTGCTGATCACTCTCGGGGACCAGGACATAGACCTGTCGCCATCGTTTGTCATCTTCCTGTCCACCCGGGATCCAACTGTCGAGTTCCCACCAGATCTCTGTTCCCGGGTTACTTTTGTAAACTTCACAGTTACCCGTAGCAGTTTACAAAGCCAGTGTCTAAATGAAGTACTTAAAGCAGAAAGACCTGATGTGGACGAGAAACGATCTGATCTTCTTAAACTTCAAGGGGAATTTCAGCTCCGTTTGCGTCAGCTGGAAAAATCTCTACTACAAGCTCTGAACGAGGTGAAAGGGCGCATTTTGGATGACGACACGATCATAACCACTCTGGAGAACCTGAAGAGAGAGGCTGCAGAGGTCACCAGGAAAGTTGAGGAGACGGACATTGTCATGCAGGAGGTGGAGACCGTGTCCCAGCAGTACCTCCCGCTCTCCACCGCCTGCAGCAGCATCTACTTCACCATGGAGTCCCTCAAGCAGATACACTTCTTGTACCAGTACTCCCTCCAGTTTTTCCTGGACATTTATCACAACGTCCTATACGAGAACCCGAACCTGAAGGGTGTCACCGACCACACACAGCGCCTGTCCATTATAACAAAGGACCTCTTCCAGGTGGCGTTTAACCGAGTGGCTCGAGGCATGCTGCATCAGGACCACATTACCTTTGCCATGCTGCTGGCAAGAATCAAACTGAAGGGCACCGTGGGGGAGCCCACCTACGATGCAGAATTCCAGCACTTCTTGAGAGGAAATGAGATTGTCCTGAGTGCTGGCTCCACCCCCAGGATCCAGGGCCTGACTGTGGAGCAGGCGGAGGCGGTGGTGAGGCTGAGCTGCCTTCCCGCGTTTAAGGACTTGATTGCAAAGGTTCAGGCAGACGAGCAATTTGGCATCTGGCTGGACAGCAGCTCCCCGGAGCAGACTGTGCCCTACCTCTGGAGTGAAGAAACACCTGCAACACCCATTGGCCAGGCCATCCACCGCCTGCTCCTGATCCAGGCTTTCCGGCCCGATCGCCTGTTGGCCATGGCCCACATGTTTGTTTCAACAAACCTTGGGGAGTCTTTCATGTCCATCATGGAGCAGCCGCTCGACCTGACCCACATTGTGGGCACAGAGGTGAAGCCCAACACTCCTGTCTTAATGTGCTCTGTGCCTGGTTATGATGCCAGTGGACATGTCGAGGACCTTGCAGCCGAGCAGAACACGCAGATCACTTCAATTGCAATCGGCTCTGCAGAAGGCTTTAACCAAGCAGATAAGGCAATAAACACCGCTGTAAAGTCGGGCAGGTGGGTGATGCTGAAGAATGTGCATCTGGCCCCAGGGTGGCTGATGCAGCTGGAGAAGAAGTTGCATTCCCTGCAGCCGCATGCCTGCTTCCGACTCTTCCTCACCATGGAGATCAACCCCAAGGTGCCTGTGAATCTGCTCCGTGCGGGCCGCATCTTTGTGTTCGAGCCACCGCCAGGGGTGAAGGCCAACATGCTGAGGACGTTCAGCAGCATTCCCGTCTCACGGATATGCAAGTCTCCCAACGAGCGTGCCCGCTTGTACTTCCTGCTGGCCTGGTTTCATGCGATCATCCAAGAACGCTTACGATACGCACCACTGGGGTGGTCAAAGAAGTATGAATTTGGAGAGTCTGACCTGCGGTCAGCTTGCGATACGGTGGACACGTGGCTGGATGACACGGCCAAGGGCAGGCAGAACATCTCACCGGATAAGATCCCGTGGTCTGCACTAAAGACCTTAATGGCCCAGTCCATTTATGGCGGGCGCGTGGACAACGAGTTTGACCAGCGTCTGCTCAACACCTTCCTGGAGCGCCTGTTCACAACCAGGAGTTTCGACAGTGAGTTTAAGCTGGCATGCAAGGTCGACGGACATAAAGACATTCAAATGCCAGATGGCATCAGGCGAGAGGAGTTTGTGCAGTGGGTGGAGTTGCTCCCCGACACCCAGACGCCCTCCTGGCTGGGCCTGCCCAACAACGCCGAGAGAGTCCTCCTTACCACACAGGGTGTGGACATGATCAGTAAAATGCTGAAGATGCAGATGTTGGAGGATGAGGACGACCTGGCCTACGCAGAGACTGAGAAGAAGACGAGGACAGACTCCACGTCCGACGGGCGCCCTGCCTGGATGCGGACACTGCACACCACCGCGTCCAACTGGCTGCACCTCATCCCCCAGACGCTGAGCCACCTCAAGCGCACCGTGGAGAATATCAAGGATCCTTTGTTCAGGTTCTTTGAGAGAGAAGTGAAGATGGGCGCAAAGCTGCTTCAGGACGTTCGCCAGGACCTTGCAGATGTCGTCCAGGTGTGCGAAGGAAAGAAGAAGCAGACCAACTACTTGCGCACGCTGATCAACGAGCTAGTGAAAGGGATCTTGCCTCGGAGCTGGTCCCACTACACGGTGCCTGCCGGCATGACCGTCATCCAGTGGGTGTCCGACTTCAGCGAGAGGATCAAACAGCTGCAGAACATCTCACTGGCAGCTGCATCTGGTGGCGCCAAGGAGCTAAAGAACATCCACGTGTGCCTGGGTGGCCTGTTCGTGCCTGAGGCGTACATCACTGCCACCAGGCAGTATGTGGCCCAGGCCAACAGCTGGTCCCTGGAGGAGCTCTGCCTGGAAGTCAACGTCACCACCTCACAGGGCGCCACCCTTGACGCTTGCAGCTTCGGAGTCACGGGTTTGAAACTTCAAGGGGCCACGTGCAACAACAACAAGCTGTCACTGTCCAATGCCATCTCAACCGCCCTTCCCCTGACGCAGCTGCGCTGGGTCAAGCAGACAAACACCGAGAAGAAGGCCAGTGTGGTAACCTTACCTGTCTACCTGAACTTCACCCGTGCAGACCTCATCTTCACCGTGGACTTCGAAATTGCTACAAAGGAGGATCCTCGCAGCTTCTACGAGCGGGGTGTCGCAGTCTTGTGCACAGAGTAAACTTTTCTAGCTGCCCCTTTCTGTAATAGTGAAAGTTGGTATTTAACATTTATTCATTTTTAAAATATTTGGAAGGTCTGAGCTTGTGAAAAGAAAGTGGTTGGTCTGAGGTTGGAGGAAGCTGAATGGAATCTGACGGTTGGGAGTGGTGGAAATTGGAAGGATACCAGGAGGTATTTGGGAAGGCCAATGGCGTGGCTCCTTTGAGGAAATAAAACACTAAGCATGAGCCGGCTCCGCCTCTTCTGTCTCCGCTTTCA